EMAIL THIS PAGE TO A FRIEND

TRIM11

tripartite motif containing 11

Synonyms: BIA1 RNF92
Gene ID:
Human(81559) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to the nucleus and the cytoplasm. Its function has not been identified. [provided by RefSeq, Jul 2008]
Mouse(94091) tripartite motif-containing 11
Rat(360534) tripartite motif-containing 11
dog(482205) tripartite motif containing 11
cow(514580) tripartite motif containing 11
sheep(101121600) tripartite motif containing 11
naked mole-rat(101720330) tripartite motif containing 11
domestic guinea pig(100712952) tripartite motif containing 11
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053168 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053168 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053168 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145214 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145214 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145214 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145214 Rosetta Predictions human pricing
NM_001108276 Rosetta Predictions rat pricing
NM_053168 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033999 predicted 727
2 SASI_Hs01_00034001 predicted 649
3 SASI_Hs02_00365060 predicted 1749
4 SASI_Hs01_00034002 predicted 1487
5 SASI_Hs02_00365061 predicted 1485
6 SASI_Hs01_00034003 predicted 1477
7 SASI_Hs01_00034004 predicted 1606
8 SASI_Hs01_00034005 predicted 1993
9 SASI_Hs01_00034006 predicted 1765
10 SASI_Hs01_00034008 predicted 1509
11 SASI_Hs01_00034000 predicted 1147
12 SASI_Hs01_00034007 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108276 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237064 predicted 2027
2 SASI_Rn02_00237065 predicted 1694
3 SASI_Rn02_00237066 predicted 1965
4 SASI_Rn02_00237067 predicted 928
5 SASI_Rn02_00237068 predicted 1652
6 SASI_Rn02_00237069 predicted 1811
7 SASI_Rn02_00237070 predicted 848
8 SASI_Rn02_00237071 predicted 1661
9 SASI_Rn02_00237072 predicted 1787
10 SASI_Rn02_00237073 predicted 1918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053168 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121086 predicted 1855
2 SASI_Mm01_00121087 predicted 1883
3 SASI_Mm01_00121088 predicted 1594
4 SASI_Mm01_00121089 predicted 844
5 SASI_Mm01_00121090 predicted 1892
6 SASI_Mm01_00121091 predicted 2014
7 SASI_Mm01_00121092 predicted 1677
8 SASI_Mm01_00121093 predicted 1776
9 SASI_Mm01_00121094 predicted 1525
10 SASI_Mm01_00121095 predicted 2027
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053168
VALIDATED
TRIM11 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 11
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053168.1-1192s1c1
Sequence:CCGGCGTGTGTAAAGAAACTGCCAACTCGAGTTGGCAGTTTCTTTACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053168.1-562s1c1
Sequence:CCGGGAAACAAATGGAGGACGCAATCTCGAGATTGCGTCCTCCATTTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053168.1-1440s1c1
Sequence:CCGGCCCTCTTCTCACCTCTGTCAACTCGAGTTGACAGAGGTGAGAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053168.1-842s1c1
Sequence:CCGGCTGGGTTTACTGCAGGACATTCTCGAGAATGTCCTGCAGTAAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053168.1-549s1c1
Sequence:CCGGTGGAGCACCTACGGAAACAAACTCGAGTTTGTTTCCGTAGGTGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053168.1-1385s21c1
Sequence:CCGGGATGGGTCGCTGCTGTTTATCCTCGAGGATAAACAGCAGCGACCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053168.1-1483s21c1
Sequence:CCGGCTGCAGGCTGATAGGTGTATCCTCGAGGATACACCTATCAGCCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053168.1-1440s21c1
Sequence:CCGGCCCTCTTCTCACCTCTGTCAACTCGAGTTGACAGAGGTGAGAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053168.1-1008s21c1
Sequence:CCGGCCAACCCTGAGCTGGTCTTATCTCGAGATAAGACCAGCTCAGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053168.1-2028s21c1
Sequence:CCGGACATTTGTATTCGGCACATAACTCGAGTTATGTGCCGAATACAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053168
VALIDATED
TRIM11 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 11
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053168.1-1192s1c1
Sequence:CCGGCGTGTGTAAAGAAACTGCCAACTCGAGTTGGCAGTTTCTTTACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053168.1-562s1c1
Sequence:CCGGGAAACAAATGGAGGACGCAATCTCGAGATTGCGTCCTCCATTTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053168.1-1440s1c1
Sequence:CCGGCCCTCTTCTCACCTCTGTCAACTCGAGTTGACAGAGGTGAGAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053168.1-842s1c1
Sequence:CCGGCTGGGTTTACTGCAGGACATTCTCGAGAATGTCCTGCAGTAAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053168.1-549s1c1
Sequence:CCGGTGGAGCACCTACGGAAACAAACTCGAGTTTGTTTCCGTAGGTGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053168.1-1385s21c1
Sequence:CCGGGATGGGTCGCTGCTGTTTATCCTCGAGGATAAACAGCAGCGACCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053168.1-1483s21c1
Sequence:CCGGCTGCAGGCTGATAGGTGTATCCTCGAGGATACACCTATCAGCCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053168.1-1440s21c1
Sequence:CCGGCCCTCTTCTCACCTCTGTCAACTCGAGTTGACAGAGGTGAGAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053168.1-1008s21c1
Sequence:CCGGCCAACCCTGAGCTGGTCTTATCTCGAGATAAGACCAGCTCAGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053168.1-2028s21c1
Sequence:CCGGACATTTGTATTCGGCACATAACTCGAGTTATGTGCCGAATACAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053168
VALIDATED
TRIM11 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 11
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053168.1-1192s1c1
Sequence:CCGGCGTGTGTAAAGAAACTGCCAACTCGAGTTGGCAGTTTCTTTACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053168.1-562s1c1
Sequence:CCGGGAAACAAATGGAGGACGCAATCTCGAGATTGCGTCCTCCATTTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053168.1-1440s1c1
Sequence:CCGGCCCTCTTCTCACCTCTGTCAACTCGAGTTGACAGAGGTGAGAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053168.1-842s1c1
Sequence:CCGGCTGGGTTTACTGCAGGACATTCTCGAGAATGTCCTGCAGTAAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053168.1-549s1c1
Sequence:CCGGTGGAGCACCTACGGAAACAAACTCGAGTTTGTTTCCGTAGGTGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053168.1-1385s21c1
Sequence:CCGGGATGGGTCGCTGCTGTTTATCCTCGAGGATAAACAGCAGCGACCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053168.1-1483s21c1
Sequence:CCGGCTGCAGGCTGATAGGTGTATCCTCGAGGATACACCTATCAGCCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053168.1-1440s21c1
Sequence:CCGGCCCTCTTCTCACCTCTGTCAACTCGAGTTGACAGAGGTGAGAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053168.1-1008s21c1
Sequence:CCGGCCAACCCTGAGCTGGTCTTATCTCGAGATAAGACCAGCTCAGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053168.1-2028s21c1
Sequence:CCGGACATTTGTATTCGGCACATAACTCGAGTTATGTGCCGAATACAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145214
TRIM11 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 11
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145214.2-1530s1c1
Sequence:CCGGGCTATTCATCTTTCCCGAGATCTCGAGATCTCGGGAAAGATGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145214.2-1408s1c1
Sequence:CCGGAGCTATTACAATTCCTCGGAACTCGAGTTCCGAGGAATTGTAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145214.2-1518s1c1
Sequence:CCGGCGATGGGTCACTGCTATTCATCTCGAGATGAATAGCAGTGACCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145214.2-1147s1c1
Sequence:CCGGCCTGAGCTGATCCTGTCTGAACTCGAGTTCAGACAGGATCAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145214.2-465s1c1
Sequence:CCGGGCTTGCTAAGATGGCCGAGATCTCGAGATCTCGGCCATCTTAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145214.2-320s21c1
Sequence:CCGGACTTCACGGATCCGGTGATGACTCGAGTCATCACCGGATCCGTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145214.2-1995s21c1
Sequence:CCGGAGAATCCAGGGTTCACCTAAGCTCGAGCTTAGGTGAACCCTGGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145214.2-1883s21c1
Sequence:CCGGAGCCACCGGGTGCCACTTAATCTCGAGATTAAGTGGCACCCGGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145214
TRIM11 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 11
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145214.2-1530s1c1
Sequence:CCGGGCTATTCATCTTTCCCGAGATCTCGAGATCTCGGGAAAGATGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145214.2-1408s1c1
Sequence:CCGGAGCTATTACAATTCCTCGGAACTCGAGTTCCGAGGAATTGTAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145214.2-1518s1c1
Sequence:CCGGCGATGGGTCACTGCTATTCATCTCGAGATGAATAGCAGTGACCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145214.2-1147s1c1
Sequence:CCGGCCTGAGCTGATCCTGTCTGAACTCGAGTTCAGACAGGATCAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145214.2-465s1c1
Sequence:CCGGGCTTGCTAAGATGGCCGAGATCTCGAGATCTCGGCCATCTTAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145214.2-320s21c1
Sequence:CCGGACTTCACGGATCCGGTGATGACTCGAGTCATCACCGGATCCGTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145214.2-1995s21c1
Sequence:CCGGAGAATCCAGGGTTCACCTAAGCTCGAGCTTAGGTGAACCCTGGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145214.2-1883s21c1
Sequence:CCGGAGCCACCGGGTGCCACTTAATCTCGAGATTAAGTGGCACCCGGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145214
TRIM11 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 11
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145214.2-1530s1c1
Sequence:CCGGGCTATTCATCTTTCCCGAGATCTCGAGATCTCGGGAAAGATGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145214.2-1408s1c1
Sequence:CCGGAGCTATTACAATTCCTCGGAACTCGAGTTCCGAGGAATTGTAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145214.2-1518s1c1
Sequence:CCGGCGATGGGTCACTGCTATTCATCTCGAGATGAATAGCAGTGACCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145214.2-1147s1c1
Sequence:CCGGCCTGAGCTGATCCTGTCTGAACTCGAGTTCAGACAGGATCAGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145214.2-465s1c1
Sequence:CCGGGCTTGCTAAGATGGCCGAGATCTCGAGATCTCGGCCATCTTAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145214.2-320s21c1
Sequence:CCGGACTTCACGGATCCGGTGATGACTCGAGTCATCACCGGATCCGTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145214.2-1995s21c1
Sequence:CCGGAGAATCCAGGGTTCACCTAAGCTCGAGCTTAGGTGAACCCTGGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145214.2-1883s21c1
Sequence:CCGGAGCCACCGGGTGCCACTTAATCTCGAGATTAAGTGGCACCCGGTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks