EMAIL THIS PAGE TO A FRIEND

TRIM13

tripartite motif containing 13

Synonyms: CAR DLEU5 LEU5 RFP2 RNF77
Gene ID:
Human(10206) Summary: This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This gene is located on chromosome 13 within the minimal deletion region for B-cell chronic lymphocytic leukemia. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(66597) tripartite motif-containing 13
Rat(364398) tripartite motif-containing 13
cow(535190) tripartite motif containing 13
sheep(101118367) tripartite motif containing 13
domestic guinea pig(100720557) tripartite motif containing 13
naked mole-rat(101720863) tripartite motif containing 13
Domestic Rabbit(100338599) tripartite motif containing 13
Zebrafish(553630) tripartite motif-containing 13
chicken(418872) tripartite motif containing 13
domestic cat(101093233) tripartite motif containing 13
Horse(100055194) tripartite motif containing 13
dog(607845) tripartite motif containing 13
229 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005798 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005798 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005798 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023233 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023233 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023233 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007278 Rosetta Predictions human pricing
NM_005798 Rosetta Predictions human pricing
NM_052811 Rosetta Predictions human pricing
NM_213590 Rosetta Predictions human pricing
NM_001012210 Rosetta Predictions rat pricing
XM_573800 Rosetta Predictions rat pricing
NM_023233 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206004 predicted 947
2 SASI_Hs02_00305300 predicted 1335
3 SASI_Hs01_00206005 predicted 1071
4 SASI_Hs01_00206006 predicted 634
5 SASI_Hs01_00206008 predicted 1702
6 SASI_Hs02_00305301 predicted 844
7 SASI_Hs02_00305302 predicted 889
8 SASI_Hs01_00206012 predicted 1426
9 SASI_Hs01_00206013 predicted 1401
10 SASI_Hs02_00305303 predicted 1723
11 SASI_Hs01_00206007 predicted 454
12 SASI_Hs01_00206009 predicted 450
13 SASI_Hs01_00206010 predicted 601
14 SASI_Hs01_00206011 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085303 predicted 748
2 SASI_Hs02_00340302 predicted 1134
3 SASI_Hs01_00085304 predicted 876
4 SASI_Hs01_00085305 predicted 427
5 SASI_Hs01_00085307 predicted 1509
6 SASI_Hs02_00340303 predicted 640
7 SASI_Hs02_00340304 predicted 695
8 SASI_Hs01_00085311 predicted 1228
9 SASI_Hs01_00085312 predicted 1197
10 SASI_Hs02_00340305 predicted 1526
11 SASI_Hs01_00085306 predicted 254
12 SASI_Hs01_00085308 predicted 244
13 SASI_Hs01_00085309 predicted 410
14 SASI_Hs01_00085310 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240796 predicted 832
2 SASI_Hs02_00361486 predicted 1218
3 SASI_Hs01_00240797 predicted 961
4 SASI_Hs01_00240798 predicted 512
5 SASI_Hs01_00240800 predicted 1592
6 SASI_Hs02_00361487 predicted 733
7 SASI_Hs02_00361488 predicted 776
8 SASI_Hs01_00240804 predicted 1310
9 SASI_Hs01_00240805 predicted 1286
10 SASI_Hs02_00361489 predicted 1606
11 SASI_Hs01_00240799 predicted 340
12 SASI_Hs01_00240801 predicted 333
13 SASI_Hs01_00240802 predicted 494
14 SASI_Hs01_00240803 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161065 predicted 1281
2 SASI_Hs02_00374262 predicted 1673
3 SASI_Hs01_00161066 predicted 1412
4 SASI_Hs01_00161067 predicted 965
5 SASI_Hs01_00161069 predicted 2040
6 SASI_Hs02_00374263 predicted 1183
7 SASI_Hs02_00374264 predicted 1226
8 SASI_Hs01_00161073 predicted 1756
9 SASI_Hs01_00161074 predicted 1741
10 SASI_Hs02_00374265 predicted 2059
11 SASI_Hs01_00161068 predicted 789
12 SASI_Hs01_00161070 predicted 777
13 SASI_Hs01_00161071 predicted 942
14 SASI_Hs01_00161072 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012210 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076349 predicted 910
2 SASI_Rn01_00076350 predicted 641
3 SASI_Rn01_00076351 predicted 855
4 SASI_Rn01_00076352 predicted 845
5 SASI_Rn01_00076354 predicted 340
6 SASI_Rn01_00076355 predicted 310
7 SASI_Rn01_00076356 predicted 345
8 SASI_Rn02_00200456 predicted 832
9 SASI_Rn01_00076357 predicted 726
10 SASI_Rn01_00076358 predicted 959
11 SASI_Rn01_00076353 predicted 665
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573800 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00191843 predicted 1688
2 SASI_Rn01_00191844 predicted 1684
3 SASI_Rn01_00191845 predicted 1698
4 SASI_Rn01_00191846 predicted 1553
5 SASI_Rn01_00191847 predicted 1595
6 SASI_Rn01_00191848 predicted 1564
7 SASI_Rn01_00191849 predicted 1648
8 SASI_Rn01_00191850 predicted 1643
9 SASI_Rn01_00191851 predicted 1648
10 SASI_Rn01_00191852 predicted 1620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023233 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049302 predicted 757
2 SASI_Mm01_00049304 predicted 910
3 SASI_Mm01_00049305 predicted 342
4 SASI_Mm01_00049306 predicted 346
5 SASI_Mm01_00049307 predicted 1299
6 SASI_Mm01_00049308 predicted 1172
7 SASI_Mm01_00049309 predicted 736
8 SASI_Mm01_00049310 predicted 311
9 SASI_Mm01_00049311 predicted 726
10 SASI_Mm02_00326985 predicted 1303
11 SASI_Mm01_00049303 predicted 828
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005798
VALIDATED
TRIM13 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 13
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005798.2-216s1c1
Sequence:CCGGCCCTATTTGTTGTAGTCTGTTCTCGAGAACAGACTACAACAAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005798.2-459s1c1
Sequence:CCGGGCCAGTATGCAAAGGACACTTCTCGAGAAGTGTCCTTTGCATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005798.2-811s1c1
Sequence:CCGGCTTGCTGTTATGCAAGCATATCTCGAGATATGCTTGCATAACAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005798.2-356s1c1
Sequence:CCGGGCCGTAAGGAAACTTCAGCTACTCGAGTAGCTGAAGTTTCCTTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_005798.2-1232s1c1
Sequence:CCGGGCTGTCTTTCAAACTTCACTTCTCGAGAAGTGAAGTTTGAAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005798.3-2230s21c1
Sequence:CCGGGGTATTGAAGGTACTAATTAACTCGAGTTAATTAGTACCTTCAATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005798.3-1041s21c1
Sequence:CCGGTTTGCCTGCAAGCCCTTTAATCTCGAGATTAAAGGGCTTGCAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005798.3-752s21c1
Sequence:CCGGTGACTAAAGATTCAGATAAAGCTCGAGCTTTATCTGAATCTTTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005798.3-1228s21c1
Sequence:CCGGATGTTCCTAGAATGGTCATTACTCGAGTAATGACCATTCTAGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_005798.3-426s21c1
Sequence:CCGGTAATAGCCTGCAGGTTAATTACTCGAGTAATTAACCTGCAGGCTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005798
VALIDATED
TRIM13 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 13
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005798.2-216s1c1
Sequence:CCGGCCCTATTTGTTGTAGTCTGTTCTCGAGAACAGACTACAACAAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005798.2-459s1c1
Sequence:CCGGGCCAGTATGCAAAGGACACTTCTCGAGAAGTGTCCTTTGCATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005798.2-811s1c1
Sequence:CCGGCTTGCTGTTATGCAAGCATATCTCGAGATATGCTTGCATAACAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005798.2-356s1c1
Sequence:CCGGGCCGTAAGGAAACTTCAGCTACTCGAGTAGCTGAAGTTTCCTTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_005798.2-1232s1c1
Sequence:CCGGGCTGTCTTTCAAACTTCACTTCTCGAGAAGTGAAGTTTGAAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005798.3-2230s21c1
Sequence:CCGGGGTATTGAAGGTACTAATTAACTCGAGTTAATTAGTACCTTCAATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005798.3-1041s21c1
Sequence:CCGGTTTGCCTGCAAGCCCTTTAATCTCGAGATTAAAGGGCTTGCAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005798.3-752s21c1
Sequence:CCGGTGACTAAAGATTCAGATAAAGCTCGAGCTTTATCTGAATCTTTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005798.3-1228s21c1
Sequence:CCGGATGTTCCTAGAATGGTCATTACTCGAGTAATGACCATTCTAGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_005798.3-426s21c1
Sequence:CCGGTAATAGCCTGCAGGTTAATTACTCGAGTAATTAACCTGCAGGCTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005798
VALIDATED
TRIM13 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 13
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005798.2-216s1c1
Sequence:CCGGCCCTATTTGTTGTAGTCTGTTCTCGAGAACAGACTACAACAAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005798.2-459s1c1
Sequence:CCGGGCCAGTATGCAAAGGACACTTCTCGAGAAGTGTCCTTTGCATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005798.2-811s1c1
Sequence:CCGGCTTGCTGTTATGCAAGCATATCTCGAGATATGCTTGCATAACAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005798.2-356s1c1
Sequence:CCGGGCCGTAAGGAAACTTCAGCTACTCGAGTAGCTGAAGTTTCCTTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_005798.2-1232s1c1
Sequence:CCGGGCTGTCTTTCAAACTTCACTTCTCGAGAAGTGAAGTTTGAAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005798.3-2230s21c1
Sequence:CCGGGGTATTGAAGGTACTAATTAACTCGAGTTAATTAGTACCTTCAATACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005798.3-1041s21c1
Sequence:CCGGTTTGCCTGCAAGCCCTTTAATCTCGAGATTAAAGGGCTTGCAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005798.3-752s21c1
Sequence:CCGGTGACTAAAGATTCAGATAAAGCTCGAGCTTTATCTGAATCTTTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005798.3-1228s21c1
Sequence:CCGGATGTTCCTAGAATGGTCATTACTCGAGTAATGACCATTCTAGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_005798.3-426s21c1
Sequence:CCGGTAATAGCCTGCAGGTTAATTACTCGAGTAATTAACCTGCAGGCTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023233
VALIDATED
TRIM13 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 13
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023233.1-1366s1c1
Sequence:CCGGGTTCTGCTTCTTGATGGGATTCTCGAGAATCCCATCAAGAAGCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023233.1-749s1c1
Sequence:CCGGCTTGCAGTTATGCAAACCTATCTCGAGATAGGTTTGCATAACTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023233.1-600s1c1
Sequence:CCGGCCCGCTTGGATACTTTGGAAACTCGAGTTTCCAAAGTATCCAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023233.1-331s1c1
Sequence:CCGGGCAGGTCAATTACTCCCTAAACTCGAGTTTAGGGAGTAATTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023233.1-651s1c1
Sequence:CCGGCGAAGGATTCAGATAAAGTAACTCGAGTTACTTTATCTGAATCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023233.2-433s21c1
Sequence:GTACCGGCATCTTCTGCGTAACTGATATCTCGAGATATCAGTTACGCAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023233.2-919s21c1
Sequence:GTACCGGTCCTTTGCCACACTCTAATTTCTCGAGAAATTAGAGTGTGGCAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023233.2-1361s21c1
Sequence:CCGGACACAGTTCTGCTTCTTGATGCTCGAGCATCAAGAAGCAGAACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023233.2-845s21c1
Sequence:CCGGGATGTCTCAGAACCTATTATACTCGAGTATAATAGGTTCTGAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023233.2-648s21c1
Sequence:CCGGTCACGAAGGATTCAGATAAAGCTCGAGCTTTATCTGAATCCTTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023233
VALIDATED
TRIM13 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 13
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023233.1-1366s1c1
Sequence:CCGGGTTCTGCTTCTTGATGGGATTCTCGAGAATCCCATCAAGAAGCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023233.1-749s1c1
Sequence:CCGGCTTGCAGTTATGCAAACCTATCTCGAGATAGGTTTGCATAACTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023233.1-600s1c1
Sequence:CCGGCCCGCTTGGATACTTTGGAAACTCGAGTTTCCAAAGTATCCAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023233.1-331s1c1
Sequence:CCGGGCAGGTCAATTACTCCCTAAACTCGAGTTTAGGGAGTAATTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023233.1-651s1c1
Sequence:CCGGCGAAGGATTCAGATAAAGTAACTCGAGTTACTTTATCTGAATCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023233.2-433s21c1
Sequence:GTACCGGCATCTTCTGCGTAACTGATATCTCGAGATATCAGTTACGCAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023233.2-919s21c1
Sequence:GTACCGGTCCTTTGCCACACTCTAATTTCTCGAGAAATTAGAGTGTGGCAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023233.2-1361s21c1
Sequence:CCGGACACAGTTCTGCTTCTTGATGCTCGAGCATCAAGAAGCAGAACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023233.2-845s21c1
Sequence:CCGGGATGTCTCAGAACCTATTATACTCGAGTATAATAGGTTCTGAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023233.2-648s21c1
Sequence:CCGGTCACGAAGGATTCAGATAAAGCTCGAGCTTTATCTGAATCCTTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023233
VALIDATED
TRIM13 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 13
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023233.1-1366s1c1
Sequence:CCGGGTTCTGCTTCTTGATGGGATTCTCGAGAATCCCATCAAGAAGCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023233.1-749s1c1
Sequence:CCGGCTTGCAGTTATGCAAACCTATCTCGAGATAGGTTTGCATAACTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023233.1-600s1c1
Sequence:CCGGCCCGCTTGGATACTTTGGAAACTCGAGTTTCCAAAGTATCCAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023233.1-331s1c1
Sequence:CCGGGCAGGTCAATTACTCCCTAAACTCGAGTTTAGGGAGTAATTGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_023233.1-651s1c1
Sequence:CCGGCGAAGGATTCAGATAAAGTAACTCGAGTTACTTTATCTGAATCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023233.2-433s21c1
Sequence:GTACCGGCATCTTCTGCGTAACTGATATCTCGAGATATCAGTTACGCAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023233.2-919s21c1
Sequence:GTACCGGTCCTTTGCCACACTCTAATTTCTCGAGAAATTAGAGTGTGGCAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023233.2-1361s21c1
Sequence:CCGGACACAGTTCTGCTTCTTGATGCTCGAGCATCAAGAAGCAGAACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023233.2-845s21c1
Sequence:CCGGGATGTCTCAGAACCTATTATACTCGAGTATAATAGGTTCTGAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023233.2-648s21c1
Sequence:CCGGTCACGAAGGATTCAGATAAAGCTCGAGCTTTATCTGAATCCTTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks