EMAIL THIS PAGE TO A FRIEND

TRIM14

tripartite motif containing 14

Gene ID:
Human(9830) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies and its function has not been determined. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Mouse(74735) tripartite motif-containing 14
Rat(313236) tripartite motif-containing 14
chicken(427282) tripartite motif containing 14
dog(612123) tripartite motif containing 14
domestic cat(101092555) tripartite motif containing 14
Domestic Rabbit(100347367) tripartite motif containing 14
naked mole-rat(101721225) tripartite motif containing 14
domestic guinea pig(100713564) tripartite motif containing 14
cow(522632) tripartite motif containing 14
sheep(101103791) tripartite motif containing 14
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014788 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014788 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014788 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029077 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029077 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029077 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122661 MISSION® esiRNA esiRNA human TRIM14 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014788 Rosetta Predictions human pricing
NM_033219 Rosetta Predictions human pricing
NM_033220 Rosetta Predictions human pricing
NM_033221 Rosetta Predictions human pricing
NM_001107934 Rosetta Predictions rat pricing
NM_029077 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014788 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193468 predicted 279
2 SASI_Hs01_00193469 predicted 308
3 SASI_Hs01_00193470 predicted 264
4 SASI_Hs01_00193472 predicted 363
5 SASI_Hs01_00193473 predicted 313
6 SASI_Hs01_00193474 predicted 387
7 SASI_Hs01_00193475 predicted 306
8 SASI_Hs02_00346288 predicted 215
9 SASI_Hs01_00193476 predicted 299
10 SASI_Hs02_00346289 predicted 258
11 SASI_Hs01_00193471 predicted 228
12 SASI_Hs01_00193477 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159153 predicted 279
2 SASI_Hs01_00159154 predicted 303
3 SASI_Hs01_00159155 predicted 271
4 SASI_Hs01_00159157 predicted 359
5 SASI_Hs01_00159158 predicted 313
6 SASI_Hs01_00159159 predicted 387
7 SASI_Hs01_00159160 predicted 310
8 SASI_Hs02_00361012 predicted 214
9 SASI_Hs01_00159161 predicted 293
10 SASI_Hs02_00361013 predicted 261
11 SASI_Hs01_00159156 predicted 227
12 SASI_Hs01_00159162 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033220 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158484 predicted 290
2 SASI_Hs01_00158485 predicted 317
3 SASI_Hs01_00158486 predicted 276
4 SASI_Hs01_00158488 predicted 364
5 SASI_Hs01_00158489 predicted 322
6 SASI_Hs01_00158490 predicted 394
7 SASI_Hs01_00158491 predicted 319
8 SASI_Hs02_00361014 predicted 227
9 SASI_Hs01_00158492 predicted 299
10 SASI_Hs02_00361015 predicted 260
11 SASI_Hs01_00158487 predicted 230
12 SASI_Hs01_00158493 predicted 240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087599 predicted 285
2 SASI_Hs01_00087600 predicted 309
3 SASI_Hs01_00087601 predicted 268
4 SASI_Hs01_00087603 predicted 358
5 SASI_Hs01_00087604 predicted 305
6 SASI_Hs01_00087605 predicted 386
7 SASI_Hs01_00087606 predicted 311
8 SASI_Hs02_00361016 predicted 217
9 SASI_Hs01_00087607 predicted 293
10 SASI_Hs02_00361017 predicted 254
11 SASI_Hs01_00087602 predicted 223
12 SASI_Hs01_00087608 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107934 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233725 predicted 1164
2 SASI_Rn02_00233726 predicted 1301
3 SASI_Rn02_00233727 predicted 251
4 SASI_Rn02_00233728 predicted 540
5 SASI_Rn02_00233729 predicted 281
6 SASI_Rn02_00233730 predicted 261
7 SASI_Rn02_00233731 predicted 1289
8 SASI_Rn02_00233732 predicted 1352
9 SASI_Rn02_00233733 predicted 1372
10 SASI_Rn02_00233734 predicted 1072
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029077 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120648 predicted 358
2 SASI_Mm01_00120649 predicted 673
3 SASI_Mm01_00120650 predicted 415
4 SASI_Mm01_00120651 predicted 531
5 SASI_Mm01_00120652 predicted 324
6 SASI_Mm01_00120653 predicted 274
7 SASI_Mm01_00120654 predicted 317
8 SASI_Mm01_00120655 predicted 1166
9 SASI_Mm02_00334839 predicted 411
10 SASI_Mm02_00334840 predicted 1149
11 SASI_Mm01_00120646 predicted 837
12 SASI_Mm01_00120647 predicted 404
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014788
VALIDATED
TRIM14 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 14
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014788.2-1580s21c1
Sequence:CCGGACCATCACTTAAACTACTTTACTCGAGTAAAGTAGTTTAAGTGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014788.2-1515s21c1
Sequence:CCGGAGTTTCAAACAGGCCCTAAACCTCGAGGTTTAGGGCCTGTTTGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014788.2-659s21c1
Sequence:CCGGGAAGCCGTGGAGAGTACATTACTCGAGTAATGTACTCTCCACGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014788.2-272s21c1
Sequence:CCGGGACAACATAACCCAGATAGAACTCGAGTTCTATCTGGGTTATGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014788.2-1722s21c1
Sequence:CCGGGTAAACGTTTGTGAATGAATGCTCGAGCATTCATTCACAAACGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014788.2-628s1c1
Sequence:CCGGGCCCGTCAAGAGCTTCTTTAACTCGAGTTAAAGAAGCTCTTGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014788.2-784s1c1
Sequence:CCGGGCGATCGCTATTGCTGAAATACTCGAGTATTTCAGCAATAGCGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_014788.2-685s1c1
Sequence:CCGGGCCATTGGACATTCGCCTTAACTCGAGTTAAGGCGAATGTCCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_014788.2-362s1c1
Sequence:CCGGCTCAGATTACTACTTGACGAACTCGAGTTCGTCAAGTAGTAATCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014788.2-314s1c1
Sequence:CCGGGCTAATGCAGAGTCAAGTAAACTCGAGTTTACTTGACTCTGCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014788
VALIDATED
TRIM14 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 14
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014788.2-1580s21c1
Sequence:CCGGACCATCACTTAAACTACTTTACTCGAGTAAAGTAGTTTAAGTGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014788.2-1515s21c1
Sequence:CCGGAGTTTCAAACAGGCCCTAAACCTCGAGGTTTAGGGCCTGTTTGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014788.2-659s21c1
Sequence:CCGGGAAGCCGTGGAGAGTACATTACTCGAGTAATGTACTCTCCACGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014788.2-272s21c1
Sequence:CCGGGACAACATAACCCAGATAGAACTCGAGTTCTATCTGGGTTATGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014788.2-1722s21c1
Sequence:CCGGGTAAACGTTTGTGAATGAATGCTCGAGCATTCATTCACAAACGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014788.2-628s1c1
Sequence:CCGGGCCCGTCAAGAGCTTCTTTAACTCGAGTTAAAGAAGCTCTTGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014788.2-784s1c1
Sequence:CCGGGCGATCGCTATTGCTGAAATACTCGAGTATTTCAGCAATAGCGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_014788.2-685s1c1
Sequence:CCGGGCCATTGGACATTCGCCTTAACTCGAGTTAAGGCGAATGTCCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_014788.2-362s1c1
Sequence:CCGGCTCAGATTACTACTTGACGAACTCGAGTTCGTCAAGTAGTAATCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014788.2-314s1c1
Sequence:CCGGGCTAATGCAGAGTCAAGTAAACTCGAGTTTACTTGACTCTGCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014788
VALIDATED
TRIM14 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 14
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014788.2-1580s21c1
Sequence:CCGGACCATCACTTAAACTACTTTACTCGAGTAAAGTAGTTTAAGTGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014788.2-1515s21c1
Sequence:CCGGAGTTTCAAACAGGCCCTAAACCTCGAGGTTTAGGGCCTGTTTGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014788.2-659s21c1
Sequence:CCGGGAAGCCGTGGAGAGTACATTACTCGAGTAATGTACTCTCCACGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014788.2-272s21c1
Sequence:CCGGGACAACATAACCCAGATAGAACTCGAGTTCTATCTGGGTTATGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014788.2-1722s21c1
Sequence:CCGGGTAAACGTTTGTGAATGAATGCTCGAGCATTCATTCACAAACGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014788.2-628s1c1
Sequence:CCGGGCCCGTCAAGAGCTTCTTTAACTCGAGTTAAAGAAGCTCTTGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014788.2-784s1c1
Sequence:CCGGGCGATCGCTATTGCTGAAATACTCGAGTATTTCAGCAATAGCGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_014788.2-685s1c1
Sequence:CCGGGCCATTGGACATTCGCCTTAACTCGAGTTAAGGCGAATGTCCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_014788.2-362s1c1
Sequence:CCGGCTCAGATTACTACTTGACGAACTCGAGTTCGTCAAGTAGTAATCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014788.2-314s1c1
Sequence:CCGGGCTAATGCAGAGTCAAGTAAACTCGAGTTTACTTGACTCTGCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029077
VALIDATED
TRIM14 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029077.1-282s1c1
Sequence:CCGGCCAGGACTGTTTAGAGTGTTTCTCGAGAAACACTCTAAACAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029077.1-415s1c1
Sequence:CCGGGAACTCAGATTACTCCTGGATCTCGAGATCCAGGAGTAATCTGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029077.1-600s1c1
Sequence:CCGGGCAGGCATATATAGCCACCAACTCGAGTTGGTGGCTATATATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029077.1-304s1c1
Sequence:CCGGGCAACCAAGAAGAGGCAACATCTCGAGATGTTGCCTCTTCTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029077.1-681s1c1
Sequence:CCGGCGAGCCTGTCAAGAACTTCTTCTCGAGAAGAAGTTCTTGACAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029077
VALIDATED
TRIM14 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029077.1-282s1c1
Sequence:CCGGCCAGGACTGTTTAGAGTGTTTCTCGAGAAACACTCTAAACAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029077.1-415s1c1
Sequence:CCGGGAACTCAGATTACTCCTGGATCTCGAGATCCAGGAGTAATCTGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029077.1-600s1c1
Sequence:CCGGGCAGGCATATATAGCCACCAACTCGAGTTGGTGGCTATATATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029077.1-304s1c1
Sequence:CCGGGCAACCAAGAAGAGGCAACATCTCGAGATGTTGCCTCTTCTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029077.1-681s1c1
Sequence:CCGGCGAGCCTGTCAAGAACTTCTTCTCGAGAAGAAGTTCTTGACAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029077
VALIDATED
TRIM14 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029077.1-282s1c1
Sequence:CCGGCCAGGACTGTTTAGAGTGTTTCTCGAGAAACACTCTAAACAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029077.1-415s1c1
Sequence:CCGGGAACTCAGATTACTCCTGGATCTCGAGATCCAGGAGTAATCTGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029077.1-600s1c1
Sequence:CCGGGCAGGCATATATAGCCACCAACTCGAGTTGGTGGCTATATATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029077.1-304s1c1
Sequence:CCGGGCAACCAAGAAGAGGCAACATCTCGAGATGTTGCCTCTTCTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029077.1-681s1c1
Sequence:CCGGCGAGCCTGTCAAGAACTTCTTCTCGAGAAGAAGTTCTTGACAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks