EMAIL THIS PAGE TO A FRIEND

TRIM15

tripartite motif containing 15

Synonyms: RNF93 ZNF178 ZNFB7
UniProtKB ID: Q9C019, A2BEC9, O95604, Q8IUX9, Q9C018
Gene ID:
Human(89870) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to the cytoplasm. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(69097) tripartite motif-containing 15
cow(540074) tripartite motif containing 15
sheep(101111752) tripartite motif containing 15
domestic cat(101098381) tripartite motif containing 15
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_289866 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_289866 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_289866 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033229 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033229 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033229 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033229 Rosetta Predictions human pricing
NM_052812 Rosetta Predictions human pricing
NM_001024134 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093999 predicted 1074
2 SASI_Hs01_00094000 predicted 1166
3 SASI_Hs01_00094001 predicted 1083
4 SASI_Hs02_00361036 predicted 821
5 SASI_Hs01_00094002 predicted 1248
6 SASI_Hs01_00094003 predicted 1337
7 SASI_Hs01_00094004 predicted 1167
8 SASI_Hs01_00094006 predicted 1698
9 SASI_Hs01_00094007 predicted 619
10 SASI_Hs02_00361037 predicted 1057
11 SASI_Hs01_00094005 predicted 1255
12 SASI_Hs01_00094008 predicted 1832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095238 predicted 141
2 SASI_Hs01_00095239 predicted 297
3 SASI_Hs01_00095240 predicted 296
4 SASI_Hs01_00095241 predicted 261
5 SASI_Hs01_00095242 predicted 21
6 SASI_Hs01_00095243 predicted 147
7 SASI_Hs01_00095244 predicted 277
8 SASI_Hs01_00095245 predicted 294
9 SASI_Hs01_00095246 predicted 312
10 SASI_Hs01_00095247 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024134 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057318 predicted 326
2 SASI_Mm02_00287551 predicted 1226
3 SASI_Mm02_00287552 predicted 777
4 SASI_Mm02_00287553 predicted 339
5 SASI_Mm02_00287554 predicted 496
6 SASI_Mm01_00057323 predicted 755
7 SASI_Mm02_00287555 predicted 674
8 SASI_Mm02_00287556 predicted 1449
9 SASI_Mm02_00287557 predicted 472
10 SASI_Mm02_00287558 predicted 326
11 SASI_Mm01_00057317 predicted 1366
12 SASI_Mm01_00057319 predicted 1025
13 SASI_Mm01_00057320 predicted 1307
14 SASI_Mm01_00057321 predicted 804
15 SASI_Mm01_00057322 predicted 1394
16 SASI_Mm01_00057324 predicted 941
17 SASI_Mm01_00057325 predicted 834
18 SASI_Mm01_00057326 predicted 882
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_289866
TRIM15 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119282    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_289866.2-1434s1c1
Sequence:CCGGCCCTAGCATTCAAATGGGAATCTCGAGATTCCCATTTGAATGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_289866.2-785s1c1
Sequence:CCGGGCAAGTGAGCTTCTGCAAGATCTCGAGATCTTGCAGAAGCTCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_289866.2-563s1c1
Sequence:CCGGGAGGTTCTGATGCAGGTTGAACTCGAGTTCAACCTGCATCAGAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_289866.2-782s1c1
Sequence:CCGGCCAGCAAGTGAGCTTCTGCAACTCGAGTTGCAGAAGCTCACTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_289866.2-489s1c1
Sequence:CCGGGTCGGTTAGAAGCTCTAAGAACTCGAGTTCTTAGAGCTTCTAACCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_289866
TRIM15 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119282    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_289866.2-1434s1c1
Sequence:CCGGCCCTAGCATTCAAATGGGAATCTCGAGATTCCCATTTGAATGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_289866.2-785s1c1
Sequence:CCGGGCAAGTGAGCTTCTGCAAGATCTCGAGATCTTGCAGAAGCTCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_289866.2-563s1c1
Sequence:CCGGGAGGTTCTGATGCAGGTTGAACTCGAGTTCAACCTGCATCAGAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_289866.2-782s1c1
Sequence:CCGGCCAGCAAGTGAGCTTCTGCAACTCGAGTTGCAGAAGCTCACTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_289866.2-489s1c1
Sequence:CCGGGTCGGTTAGAAGCTCTAAGAACTCGAGTTCTTAGAGCTTCTAACCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_289866
TRIM15 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119282    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_289866.2-1434s1c1
Sequence:CCGGCCCTAGCATTCAAATGGGAATCTCGAGATTCCCATTTGAATGCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_289866.2-785s1c1
Sequence:CCGGGCAAGTGAGCTTCTGCAAGATCTCGAGATCTTGCAGAAGCTCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_289866.2-563s1c1
Sequence:CCGGGAGGTTCTGATGCAGGTTGAACTCGAGTTCAACCTGCATCAGAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_289866.2-782s1c1
Sequence:CCGGCCAGCAAGTGAGCTTCTGCAACTCGAGTTGCAGAAGCTCACTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_289866.2-489s1c1
Sequence:CCGGGTCGGTTAGAAGCTCTAAGAACTCGAGTTCTTAGAGCTTCTAACCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033229
TRIM15 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 15
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033229.1-926s1c1
Sequence:CCGGGAGGATGTAAAGTGTCAAGAACTCGAGTTCTTGACACTTTACATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033229.1-979s1c1
Sequence:CCGGCGAAAGCAAGAAGCATCAGGTCTCGAGACCTGATGCTTCTTGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033229.1-1345s1c1
Sequence:CCGGCTTGGCGCATCATCTGGAAATCTCGAGATTTCCAGATGATGCGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033229.1-1222s1c1
Sequence:CCGGCAGGTGTGAGATGAAGACTTTCTCGAGAAAGTCTTCATCTCACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033229.2-746s21c1
Sequence:CCGGGATCTACTTCTTCTGCGAGAACTCGAGTTCTCGCAGAAGAAGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033229.2-1852s21c1
Sequence:CCGGGTTCCTGCCTTACGCTGAAAGCTCGAGCTTTCAGCGTAAGGCAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033229.2-1259s21c1
Sequence:CCGGTGTCAAGAAGATCCGTGATTTCTCGAGAAATCACGGATCTTCTTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033229.2-2001s21c1
Sequence:CCGGAGTCTCGAACAGCGGTTGTTTCTCGAGAAACAACCGCTGTTCGAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033229
TRIM15 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 15
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033229.1-926s1c1
Sequence:CCGGGAGGATGTAAAGTGTCAAGAACTCGAGTTCTTGACACTTTACATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033229.1-979s1c1
Sequence:CCGGCGAAAGCAAGAAGCATCAGGTCTCGAGACCTGATGCTTCTTGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033229.1-1345s1c1
Sequence:CCGGCTTGGCGCATCATCTGGAAATCTCGAGATTTCCAGATGATGCGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033229.1-1222s1c1
Sequence:CCGGCAGGTGTGAGATGAAGACTTTCTCGAGAAAGTCTTCATCTCACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033229.2-746s21c1
Sequence:CCGGGATCTACTTCTTCTGCGAGAACTCGAGTTCTCGCAGAAGAAGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033229.2-1852s21c1
Sequence:CCGGGTTCCTGCCTTACGCTGAAAGCTCGAGCTTTCAGCGTAAGGCAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033229.2-1259s21c1
Sequence:CCGGTGTCAAGAAGATCCGTGATTTCTCGAGAAATCACGGATCTTCTTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033229.2-2001s21c1
Sequence:CCGGAGTCTCGAACAGCGGTTGTTTCTCGAGAAACAACCGCTGTTCGAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033229
TRIM15 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 15
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033229.1-926s1c1
Sequence:CCGGGAGGATGTAAAGTGTCAAGAACTCGAGTTCTTGACACTTTACATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033229.1-979s1c1
Sequence:CCGGCGAAAGCAAGAAGCATCAGGTCTCGAGACCTGATGCTTCTTGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033229.1-1345s1c1
Sequence:CCGGCTTGGCGCATCATCTGGAAATCTCGAGATTTCCAGATGATGCGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033229.1-1222s1c1
Sequence:CCGGCAGGTGTGAGATGAAGACTTTCTCGAGAAAGTCTTCATCTCACACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033229.2-746s21c1
Sequence:CCGGGATCTACTTCTTCTGCGAGAACTCGAGTTCTCGCAGAAGAAGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033229.2-1852s21c1
Sequence:CCGGGTTCCTGCCTTACGCTGAAAGCTCGAGCTTTCAGCGTAAGGCAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033229.2-1259s21c1
Sequence:CCGGTGTCAAGAAGATCCGTGATTTCTCGAGAAATCACGGATCTTCTTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033229.2-2001s21c1
Sequence:CCGGAGTCTCGAACAGCGGTTGTTTCTCGAGAAACAACCGCTGTTCGAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks