EMAIL THIS PAGE TO A FRIEND

TRIM16

tripartite motif containing 16

Synonyms: EBBP
UniProtKB ID: O95361, Q6IAL8, Q7Z6I2, Q96BE8, Q96J43
Gene ID:
Human(10626) Summary: This gene was identified as an estrogen and anti-estrogen regulated gene in epithelial cells stably expressing estrogen receptor. The protein encoded by this gene contains two B box domains and a coiled-coiled region that are characteristic of the B box zinc finger protein family. The proteins of this family have been reported to be involved in a variety of biological processes including cell growth, differentiation and pathogenesis. Expression of this gene was detected in most tissues. Its function, however, has not yet been determined. [provided by RefSeq, Jul 2008]
Mouse(94092) tripartite motif-containing 16
Rat(303214) tripartite motif-containing 16
domestic guinea pig(100723249) tripartite motif containing 16
cow(100848152) tripartite motif containing 16
sheep(101106444) tripartite motif containing 16
Zebrafish(568734) tripartite motif-containing 16
domestic cat(101090812) tripartite motif containing 16
dog(489518) tripartite motif containing 16
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053169 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053169 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053169 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006470 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006470 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006470 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006470 Rosetta Predictions human pricing
NM_053169 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341641 predicted 1247
2 SASI_Hs01_00115355 predicted 2068
3 SASI_Hs02_00341642 predicted 1243
4 SASI_Hs02_00341643 predicted 1301
5 SASI_Hs02_00341644 predicted 1102
6 SASI_Hs02_00341645 predicted 1408
7 SASI_Hs01_00115356 predicted 825
8 SASI_Hs02_00341646 predicted 2106
9 SASI_Hs01_00115357 predicted 2075
10 SASI_Hs01_00115358 predicted 1580
11 SASI_Hs01_00115359 predicted 1670
12 SASI_Hs01_00115360 predicted 1684
13 SASI_Hs01_00115361 predicted 1499
14 SASI_Hs01_00115362 predicted 886
15 SASI_Hs01_00115363 predicted 1661
16 SASI_Hs01_00115364 predicted 1579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053169 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150000 predicted 1648
2 SASI_Mm01_00150001 predicted 1194
3 SASI_Mm01_00150002 predicted 1818
4 SASI_Mm01_00150003 predicted 1823
5 SASI_Mm01_00150004 predicted 1278
6 SASI_Mm01_00150005 predicted 1764
7 SASI_Mm01_00150006 predicted 470
8 SASI_Mm01_00150008 predicted 1267
9 SASI_Mm01_00150009 predicted 440
10 SASI_Mm02_00337722 predicted 2018
11 SASI_Mm01_00150007 predicted 2010
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053169
VALIDATED
TRIM16 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 16
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053169.2-1710s21c1
Sequence:CCGGGCTCGGTATCTATGTAAACTTCTCGAGAAGTTTACATAGATACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053169.2-479s21c1
Sequence:CCGGGCAGAGTAAGGGCAGTGAAATCTCGAGATTTCACTGCCCTTACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053169.2-1321s21c1
Sequence:CCGGCGGGATGAGTTTCTTCAATATCTCGAGATATTGAAGAAACTCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053169.2-1285s21c1
Sequence:CCGGCGCAAGTATAGGACCTCGAAACTCGAGTTTCGAGGTCCTATACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053169.2-479s1c1
Sequence:CCGGGCAGAGTAAGGGCAGTGAAATCTCGAGATTTCACTGCCCTTACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053169.2-1285s1c1
Sequence:CCGGCGCAAGTATAGGACCTCGAAACTCGAGTTTCGAGGTCCTATACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115551    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053169.2-2838s1c1
Sequence:CCGGCCTGTTTGTTTGTGCTAAGTTCTCGAGAACTTAGCACAAACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053169.2-1321s1c1
Sequence:CCGGCGGGATGAGTTTCTTCAATATCTCGAGATATTGAAGAAACTCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053169.2-1710s1c1
Sequence:CCGGGCTCGGTATCTATGTAAACTTCTCGAGAAGTTTACATAGATACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053169
VALIDATED
TRIM16 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 16
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053169.2-1710s21c1
Sequence:CCGGGCTCGGTATCTATGTAAACTTCTCGAGAAGTTTACATAGATACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053169.2-479s21c1
Sequence:CCGGGCAGAGTAAGGGCAGTGAAATCTCGAGATTTCACTGCCCTTACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053169.2-1321s21c1
Sequence:CCGGCGGGATGAGTTTCTTCAATATCTCGAGATATTGAAGAAACTCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053169.2-1285s21c1
Sequence:CCGGCGCAAGTATAGGACCTCGAAACTCGAGTTTCGAGGTCCTATACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053169.2-479s1c1
Sequence:CCGGGCAGAGTAAGGGCAGTGAAATCTCGAGATTTCACTGCCCTTACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053169.2-1285s1c1
Sequence:CCGGCGCAAGTATAGGACCTCGAAACTCGAGTTTCGAGGTCCTATACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115551    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053169.2-2838s1c1
Sequence:CCGGCCTGTTTGTTTGTGCTAAGTTCTCGAGAACTTAGCACAAACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053169.2-1321s1c1
Sequence:CCGGCGGGATGAGTTTCTTCAATATCTCGAGATATTGAAGAAACTCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053169.2-1710s1c1
Sequence:CCGGGCTCGGTATCTATGTAAACTTCTCGAGAAGTTTACATAGATACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053169
VALIDATED
TRIM16 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 16
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053169.2-1710s21c1
Sequence:CCGGGCTCGGTATCTATGTAAACTTCTCGAGAAGTTTACATAGATACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053169.2-479s21c1
Sequence:CCGGGCAGAGTAAGGGCAGTGAAATCTCGAGATTTCACTGCCCTTACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053169.2-1321s21c1
Sequence:CCGGCGGGATGAGTTTCTTCAATATCTCGAGATATTGAAGAAACTCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053169.2-1285s21c1
Sequence:CCGGCGCAAGTATAGGACCTCGAAACTCGAGTTTCGAGGTCCTATACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053169.2-479s1c1
Sequence:CCGGGCAGAGTAAGGGCAGTGAAATCTCGAGATTTCACTGCCCTTACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053169.2-1285s1c1
Sequence:CCGGCGCAAGTATAGGACCTCGAAACTCGAGTTTCGAGGTCCTATACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115551    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053169.2-2838s1c1
Sequence:CCGGCCTGTTTGTTTGTGCTAAGTTCTCGAGAACTTAGCACAAACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053169.2-1321s1c1
Sequence:CCGGCGGGATGAGTTTCTTCAATATCTCGAGATATTGAAGAAACTCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053169.2-1710s1c1
Sequence:CCGGGCTCGGTATCTATGTAAACTTCTCGAGAAGTTTACATAGATACCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006470
TRIM16 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 16
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000333849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006470.3-876s21c1
Sequence:CCGGCCGCATCAGGTGAACATCAAACTCGAGTTTGATGTTCACCTGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006470.3-2734s21c1
Sequence:CCGGCCTGCCTGTTTGTAGTAATTTCTCGAGAAATTACTACAAACAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006470.3-1248s21c1
Sequence:CCGGGCCAATGTGATGCTCTTCTTACTCGAGTAAGAAGAGCATCACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006470.3-1602s21c1
Sequence:CCGGGCCGTTGTTCAGCGCAAATATCTCGAGATATTTGCGCTGAACAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006470
TRIM16 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 16
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000333849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006470.3-876s21c1
Sequence:CCGGCCGCATCAGGTGAACATCAAACTCGAGTTTGATGTTCACCTGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006470.3-2734s21c1
Sequence:CCGGCCTGCCTGTTTGTAGTAATTTCTCGAGAAATTACTACAAACAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006470.3-1248s21c1
Sequence:CCGGGCCAATGTGATGCTCTTCTTACTCGAGTAAGAAGAGCATCACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006470.3-1602s21c1
Sequence:CCGGGCCGTTGTTCAGCGCAAATATCTCGAGATATTTGCGCTGAACAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006470
TRIM16 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 16
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000333849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006470.3-876s21c1
Sequence:CCGGCCGCATCAGGTGAACATCAAACTCGAGTTTGATGTTCACCTGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006470.3-2734s21c1
Sequence:CCGGCCTGCCTGTTTGTAGTAATTTCTCGAGAAATTACTACAAACAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006470.3-1248s21c1
Sequence:CCGGGCCAATGTGATGCTCTTCTTACTCGAGTAAGAAGAGCATCACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006470.3-1602s21c1
Sequence:CCGGGCCGTTGTTCAGCGCAAATATCTCGAGATATTTGCGCTGAACAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks