EMAIL THIS PAGE TO A FRIEND

TRIM16L

tripartite motif containing 16-like

Synonyms: TRIM70
Species: Human TRIM16L(147166)
UniProtKB ID: Q309B1, A0PK10, B2RUW6, B4DQK2, B4DWQ8
Gene ID:
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037330 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037330 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037330 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037330 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308269 predicted 312
2 SASI_Hs01_00023724 predicted 1142
3 SASI_Hs01_00023725 predicted 889
4 SASI_Hs01_00023726 predicted 569
5 SASI_Hs02_00308270 predicted 370
6 SASI_Hs01_00023727 predicted 671
7 SASI_Hs02_00308271 predicted 476
8 SASI_Hs02_00308272 predicted 504
9 SASI_Hs02_00308273 predicted 471
10 SASI_Hs02_00308274 predicted 436
11 SASI_Hs01_00023723 predicted 682
12 SASI_Hs01_00023728 predicted 689
13 SASI_Hs01_00023729 predicted 1145
14 SASI_Hs01_00023730 predicted 1229
15 SASI_Hs01_00023731 predicted 724
16 SASI_Hs01_00023732 predicted 965
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037330
TRIM16L MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 16-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037330.1-328s1c1
Sequence:CCGGGATGCTCTTCTTAGAGGAGAACTCGAGTTCTCCTCTAAGAAGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001037330.1-1809s1c1
Sequence:CCGGCCTGCCTGTTTGTAGTAATTTCTCGAGAAATTACTACAAACAGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037330.1-685s1c1
Sequence:CCGGGCGCAAATATTGGACTTCCAACTCGAGTTGGAAGTCCAATATTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037330.1-1187s1c1
Sequence:CCGGCACAAGTTTGCCTGCAAGTTTCTCGAGAAACTTGCAGGCAAACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037330.1-674s1c1
Sequence:CCGGGCCATTGTTCAGCGCAAATATCTCGAGATATTTGCGCTGAACAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037330.1-1169s21c1
Sequence:CCGGGATTCCATGACTCTGGTTCACCTCGAGGTGAACCAGAGTCATGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037330.1-729s21c1
Sequence:CCGGAGTTCCTCCAATATGTGCATGCTCGAGCATGCACATATTGGAGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037330.1-527s21c1
Sequence:CCGGTACATAGGGCTGAAGGATAAACTCGAGTTTATCCTTCAGCCCTATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037330
TRIM16L MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 16-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037330.1-328s1c1
Sequence:CCGGGATGCTCTTCTTAGAGGAGAACTCGAGTTCTCCTCTAAGAAGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001037330.1-1809s1c1
Sequence:CCGGCCTGCCTGTTTGTAGTAATTTCTCGAGAAATTACTACAAACAGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037330.1-685s1c1
Sequence:CCGGGCGCAAATATTGGACTTCCAACTCGAGTTGGAAGTCCAATATTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037330.1-1187s1c1
Sequence:CCGGCACAAGTTTGCCTGCAAGTTTCTCGAGAAACTTGCAGGCAAACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037330.1-674s1c1
Sequence:CCGGGCCATTGTTCAGCGCAAATATCTCGAGATATTTGCGCTGAACAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037330.1-1169s21c1
Sequence:CCGGGATTCCATGACTCTGGTTCACCTCGAGGTGAACCAGAGTCATGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037330.1-729s21c1
Sequence:CCGGAGTTCCTCCAATATGTGCATGCTCGAGCATGCACATATTGGAGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037330.1-527s21c1
Sequence:CCGGTACATAGGGCTGAAGGATAAACTCGAGTTTATCCTTCAGCCCTATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037330
TRIM16L MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 16-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037330.1-328s1c1
Sequence:CCGGGATGCTCTTCTTAGAGGAGAACTCGAGTTCTCCTCTAAGAAGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001037330.1-1809s1c1
Sequence:CCGGCCTGCCTGTTTGTAGTAATTTCTCGAGAAATTACTACAAACAGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037330.1-685s1c1
Sequence:CCGGGCGCAAATATTGGACTTCCAACTCGAGTTGGAAGTCCAATATTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037330.1-1187s1c1
Sequence:CCGGCACAAGTTTGCCTGCAAGTTTCTCGAGAAACTTGCAGGCAAACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037330.1-674s1c1
Sequence:CCGGGCCATTGTTCAGCGCAAATATCTCGAGATATTTGCGCTGAACAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037330.1-1169s21c1
Sequence:CCGGGATTCCATGACTCTGGTTCACCTCGAGGTGAACCAGAGTCATGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037330.1-729s21c1
Sequence:CCGGAGTTCCTCCAATATGTGCATGCTCGAGCATGCACATATTGGAGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037330.1-527s21c1
Sequence:CCGGTACATAGGGCTGAAGGATAAACTCGAGTTTATCCTTCAGCCCTATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks