EMAIL THIS PAGE TO A FRIEND

TRIM17

tripartite motif containing 17

Synonyms: RBCC RNF16 terf
UniProtKB ID: Q9Y577, B4DVJ2, Q5VST8
Gene ID:
Human(51127) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. The protein is expressed almost exclusively in the testis, but its function is unknown. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(56631) tripartite motif-containing 17
Rat(64702) tripartite motif-containing 17
dog(482204) tripartite motif containing 17
cow(618634) tripartite motif containing 17
sheep(101123033) tripartite motif containing 17
domestic guinea pig(100719636) tripartite motif containing 17
naked mole-rat(101720918) tripartite motif containing 17
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031172 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031172 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031172 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016102 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016102 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016102 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024940 Rosetta Predictions human pricing
NM_001024941 Rosetta Predictions human pricing
NM_016102 Rosetta Predictions human pricing
NM_022798 Rosetta Predictions rat pricing
NM_031172 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024940 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065785 predicted 576
2 SASI_Hs01_00065786 predicted 696
3 SASI_Hs01_00065787 predicted 957
4 SASI_Hs01_00065788 predicted 1409
5 SASI_Hs01_00065789 predicted 1205
6 SASI_Hs01_00065790 predicted 662
7 SASI_Hs01_00065791 predicted 970
8 SASI_Hs01_00065792 predicted 1075
9 SASI_Hs01_00065793 predicted 659
10 SASI_Hs01_00065794 predicted 1403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033029 predicted 498
2 SASI_Hs01_00033030 predicted 620
3 SASI_Hs01_00033031 predicted 882
4 SASI_Hs01_00033032 predicted 1326
5 SASI_Hs01_00033033 predicted 1121
6 SASI_Hs01_00033034 predicted 584
7 SASI_Hs01_00033035 predicted 893
8 SASI_Hs01_00033036 predicted 999
9 SASI_Hs01_00033037 predicted 580
10 SASI_Hs01_00033038 predicted 1330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016102 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011186 predicted 612
2 SASI_Hs01_00011187 predicted 733
3 SASI_Hs01_00011188 predicted 997
4 SASI_Hs01_00011189 predicted 1437
5 SASI_Hs01_00011190 predicted 1240
6 SASI_Hs01_00011191 predicted 702
7 SASI_Hs01_00011192 predicted 1001
8 SASI_Hs01_00011193 predicted 1106
9 SASI_Hs01_00011194 predicted 693
10 SASI_Hs01_00011195 predicted 1437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022798 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080114 predicted 479
2 SASI_Rn01_00080115 predicted 544
3 SASI_Rn01_00080117 predicted 468
4 SASI_Rn02_00263553 predicted 464
5 SASI_Rn01_00080119 predicted 1424
6 SASI_Rn02_00263554 predicted 626
7 SASI_Rn01_00080120 predicted 1110
8 SASI_Rn01_00080121 predicted 1439
9 SASI_Rn01_00080123 predicted 1348
10 SASI_Rn02_00263555 predicted 550
11 SASI_Rn01_00080116 predicted 640
12 SASI_Rn01_00080118 predicted 258
13 SASI_Rn01_00080122 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031172 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066508 predicted 1285
2 SASI_Mm02_00337003 predicted 233
3 SASI_Mm01_00066509 predicted 665
4 SASI_Mm02_00337004 predicted 1250
5 SASI_Mm01_00066510 predicted 506
6 SASI_Mm01_00066511 predicted 634
7 SASI_Mm01_00066512 predicted 1148
8 SASI_Mm01_00066513 predicted 916
9 SASI_Mm01_00066514 predicted 1289
10 SASI_Mm01_00066515 predicted 1297
11 SASI_Mm01_00066516 predicted 591
12 SASI_Mm01_00066517 predicted 589
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031172
TRIM17 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 17
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031172.2-386s21c1
Sequence:CCGGCTGTGCCAAGCACACCAAGAACTCGAGTTCTTGGTGTGCTTGGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031172.2-1479s21c1
Sequence:CCGGAGTCAGGCCAGATGGTCATCTCTCGAGAGATGACCATCTGGCCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031172.2-1395s21c1
Sequence:CCGGTGAACGATGGGTCCCACTTACCTCGAGGTAAGTGGGACCCATCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031172.1-1546s1c1
Sequence:CCGGGACACTGGGTGTGCCACAGTTCTCGAGAACTGTGGCACACCCAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031172.1-588s1c1
Sequence:CCGGCCAAGGAGGAACAGACCTTAACTCGAGTTAAGGTCTGTTCCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031172.1-1298s1c1
Sequence:CCGGCTGTTACCCAATTCCACTCTACTCGAGTAGAGTGGAATTGGGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031172.1-144s1c1
Sequence:CCGGCCATCTGCCTTGACTACTTTACTCGAGTAAAGTAGTCAAGGCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031172.1-668s1c1
Sequence:CCGGGTGGTCTTGTTTCTGGTGGAACTCGAGTTCCACCAGAAACAAGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031172
TRIM17 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 17
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031172.2-386s21c1
Sequence:CCGGCTGTGCCAAGCACACCAAGAACTCGAGTTCTTGGTGTGCTTGGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031172.2-1479s21c1
Sequence:CCGGAGTCAGGCCAGATGGTCATCTCTCGAGAGATGACCATCTGGCCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031172.2-1395s21c1
Sequence:CCGGTGAACGATGGGTCCCACTTACCTCGAGGTAAGTGGGACCCATCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031172.1-1546s1c1
Sequence:CCGGGACACTGGGTGTGCCACAGTTCTCGAGAACTGTGGCACACCCAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031172.1-588s1c1
Sequence:CCGGCCAAGGAGGAACAGACCTTAACTCGAGTTAAGGTCTGTTCCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031172.1-1298s1c1
Sequence:CCGGCTGTTACCCAATTCCACTCTACTCGAGTAGAGTGGAATTGGGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031172.1-144s1c1
Sequence:CCGGCCATCTGCCTTGACTACTTTACTCGAGTAAAGTAGTCAAGGCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031172.1-668s1c1
Sequence:CCGGGTGGTCTTGTTTCTGGTGGAACTCGAGTTCCACCAGAAACAAGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031172
TRIM17 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 17
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031172.2-386s21c1
Sequence:CCGGCTGTGCCAAGCACACCAAGAACTCGAGTTCTTGGTGTGCTTGGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031172.2-1479s21c1
Sequence:CCGGAGTCAGGCCAGATGGTCATCTCTCGAGAGATGACCATCTGGCCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031172.2-1395s21c1
Sequence:CCGGTGAACGATGGGTCCCACTTACCTCGAGGTAAGTGGGACCCATCGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031172.1-1546s1c1
Sequence:CCGGGACACTGGGTGTGCCACAGTTCTCGAGAACTGTGGCACACCCAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031172.1-588s1c1
Sequence:CCGGCCAAGGAGGAACAGACCTTAACTCGAGTTAAGGTCTGTTCCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031172.1-1298s1c1
Sequence:CCGGCTGTTACCCAATTCCACTCTACTCGAGTAGAGTGGAATTGGGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031172.1-144s1c1
Sequence:CCGGCCATCTGCCTTGACTACTTTACTCGAGTAAAGTAGTCAAGGCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031172.1-668s1c1
Sequence:CCGGGTGGTCTTGTTTCTGGTGGAACTCGAGTTCCACCAGAAACAAGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016102
TRIM17 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 17
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000033825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016102.1-655s1c1
Sequence:CCGGGAACGCATTGTGCTGGAGTTTCTCGAGAAACTCCAGCACAATGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016102.1-1516s1c1
Sequence:CCGGACAGTGACCATGTGGGTGAAACTCGAGTTTCACCCACATGGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016102.1-1296s1c1
Sequence:CCGGGACCAAGTACTTATCCACCTTCTCGAGAAGGTGGATAAGTACTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016102.1-672s1c1
Sequence:CCGGGTTTGAGAAGATGAACCTCTACTCGAGTAGAGGTTCATCTTCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016102
TRIM17 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 17
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000033825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016102.1-655s1c1
Sequence:CCGGGAACGCATTGTGCTGGAGTTTCTCGAGAAACTCCAGCACAATGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016102.1-1516s1c1
Sequence:CCGGACAGTGACCATGTGGGTGAAACTCGAGTTTCACCCACATGGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016102.1-1296s1c1
Sequence:CCGGGACCAAGTACTTATCCACCTTCTCGAGAAGGTGGATAAGTACTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016102.1-672s1c1
Sequence:CCGGGTTTGAGAAGATGAACCTCTACTCGAGTAGAGGTTCATCTTCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016102
TRIM17 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 17
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000033825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016102.1-655s1c1
Sequence:CCGGGAACGCATTGTGCTGGAGTTTCTCGAGAAACTCCAGCACAATGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016102.1-1516s1c1
Sequence:CCGGACAGTGACCATGTGGGTGAAACTCGAGTTTCACCCACATGGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016102.1-1296s1c1
Sequence:CCGGGACCAAGTACTTATCCACCTTCTCGAGAAGGTGGATAAGTACTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016102.1-672s1c1
Sequence:CCGGGTTTGAGAAGATGAACCTCTACTCGAGTAGAGGTTCATCTTCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks