EMAIL THIS PAGE TO A FRIEND

TRIM21

tripartite motif containing 21

Synonyms: RNF81 RO52 SSA SSA1
UniProtKB ID: P19474, Q5XPV5, Q96RF8
Gene ID:
Human(6737) Summary: This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The encoded protein is part of the RoSSA ribonucleoprotein, which includes a single polypeptide and one of four small RNA molecules. The RoSSA particle localizes to both the cytoplasm and the nucleus. RoSSA interacts with autoantigens in patients with Sjogren syndrome and systemic lupus erythematosus. Alternatively spliced transcript variants for this gene have been described but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
Mouse(20821) tripartite motif-containing 21
Rat(308901) tripartite motif-containing 21
Horse(100066782) tripartite motif containing 21
domestic cat(101098574) tripartite motif containing 21
dog(485226) tripartite motif containing 21
cow(359715) tripartite motif containing 21
sheep(101114640) tripartite motif containing 21
domestic guinea pig(100729320) tripartite motif containing 21
naked mole-rat(101709110) tripartite motif containing 21
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009277 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009277 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009277 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003141 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003141 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003141 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003141 Rosetta Predictions human pricing
NM_001082572 Rosetta Predictions rat pricing
XM_001069835 Rosetta Predictions rat pricing
NM_001082552 Rosetta Predictions mouse pricing
NM_009277 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060144 predicted 1500
2 SASI_Hs01_00060145 predicted 1073
3 SASI_Hs01_00060146 predicted 849
4 SASI_Hs01_00060147 predicted 1059
5 SASI_Hs01_00060148 predicted 576
6 SASI_Hs01_00060149 predicted 1239
7 SASI_Hs01_00060150 predicted 567
8 SASI_Hs01_00060151 predicted 1487
9 SASI_Hs01_00060152 predicted 1406
10 SASI_Hs02_00335140 predicted 1449
11 SASI_Hs01_00060153 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082572 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208789 predicted 947
2 SASI_Rn02_00208790 predicted 420
3 SASI_Rn02_00208791 predicted 948
4 SASI_Rn02_00208792 predicted 457
5 SASI_Rn02_00208793 predicted 1171
6 SASI_Rn02_00208794 predicted 394
7 SASI_Rn02_00208795 predicted 723
8 SASI_Rn02_00208796 predicted 299
9 SASI_Rn02_00208797 predicted 417
10 SASI_Rn02_00208798 predicted 770
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069835 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329497 predicted 949
2 SASI_Rn02_00329498 predicted 422
3 SASI_Rn02_00329499 predicted 943
4 SASI_Rn02_00329500 predicted 451
5 SASI_Rn02_00329501 predicted 1167
6 SASI_Rn02_00329502 predicted 402
7 SASI_Rn02_00329503 predicted 722
8 SASI_Rn02_00329504 predicted 299
9 SASI_Rn02_00329505 predicted 415
10 SASI_Rn02_00329506 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082552 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299355 predicted 1059
2 SASI_Mm02_00299356 predicted 388
3 SASI_Mm02_00299357 predicted 1313
4 SASI_Mm02_00299358 predicted 1300
5 SASI_Mm02_00299359 predicted 1473
6 SASI_Mm02_00299360 predicted 1325
7 SASI_Mm02_00299361 predicted 1056
8 SASI_Mm02_00299362 predicted 298
9 SASI_Mm02_00299363 predicted 1475
10 SASI_Mm02_00299364 predicted 1255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009277 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315770 predicted 1123
2 SASI_Mm01_00168782 predicted 453
3 SASI_Mm01_00168784 predicted 1382
4 SASI_Mm01_00168785 predicted 1371
5 SASI_Mm01_00168787 predicted 1543
6 SASI_Mm01_00168788 predicted 1395
7 SASI_Mm02_00315771 predicted 1123
8 SASI_Mm01_00168789 predicted 366
9 SASI_Mm02_00315772 predicted 1540
10 SASI_Mm01_00168790 predicted 1325
11 SASI_Mm01_00168783 predicted 516
12 SASI_Mm01_00168786 predicted 1551
13 SASI_Mm01_00168791 predicted 1350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009277
VALIDATED
TRIM21 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 21
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009277.3-1021s21c1
Sequence:CCGGAGGACATGTTGGGTTCATATTCTCGAGAATATGAACCCAACATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009277.3-1985s21c1
Sequence:CCGGGATACCTGTCTACTCCTATATCTCGAGATATAGGAGTAGACAGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009277.3-1131s21c1
Sequence:CCGGTGACAATGAGGAGAGGTTTAGCTCGAGCTAAACCTCTCCTCATTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009277.3-945s21c1
Sequence:CCGGGAACCTGGACACGTTAGATATCTCGAGATATCTAACGTGTCCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009277.3-1421s21c1
Sequence:CCGGTTGTCTCCTTCTACAACATAACTCGAGTTATGTTGTAGAAGGAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009277.2-2416s1c1
Sequence:CCGGGCCTTGAAGAAAGTGAAATTACTCGAGTAATTTCACTTTCTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009277.2-584s1c1
Sequence:CCGGGCCGAGAAGATGGAAATGGATCTCGAGATCCATTTCCATCTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009277.2-1499s1c1
Sequence:CCGGCCTCTAAAGCTCTGTCCACTACTCGAGTAGTGGACAGAGCTTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009277.2-319s1c1
Sequence:CCGGGCCCAATAGACATATAGCCAACTCGAGTTGGCTATATGTCTATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009277.2-1334s1c1
Sequence:CCGGCCATGCCAAATTGGGATCTTTCTCGAGAAAGATCCCAATTTGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009277
VALIDATED
TRIM21 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 21
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009277.3-1021s21c1
Sequence:CCGGAGGACATGTTGGGTTCATATTCTCGAGAATATGAACCCAACATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009277.3-1985s21c1
Sequence:CCGGGATACCTGTCTACTCCTATATCTCGAGATATAGGAGTAGACAGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009277.3-1131s21c1
Sequence:CCGGTGACAATGAGGAGAGGTTTAGCTCGAGCTAAACCTCTCCTCATTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009277.3-945s21c1
Sequence:CCGGGAACCTGGACACGTTAGATATCTCGAGATATCTAACGTGTCCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009277.3-1421s21c1
Sequence:CCGGTTGTCTCCTTCTACAACATAACTCGAGTTATGTTGTAGAAGGAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009277.2-2416s1c1
Sequence:CCGGGCCTTGAAGAAAGTGAAATTACTCGAGTAATTTCACTTTCTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009277.2-584s1c1
Sequence:CCGGGCCGAGAAGATGGAAATGGATCTCGAGATCCATTTCCATCTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009277.2-1499s1c1
Sequence:CCGGCCTCTAAAGCTCTGTCCACTACTCGAGTAGTGGACAGAGCTTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009277.2-319s1c1
Sequence:CCGGGCCCAATAGACATATAGCCAACTCGAGTTGGCTATATGTCTATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009277.2-1334s1c1
Sequence:CCGGCCATGCCAAATTGGGATCTTTCTCGAGAAAGATCCCAATTTGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009277
VALIDATED
TRIM21 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 21
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009277.3-1021s21c1
Sequence:CCGGAGGACATGTTGGGTTCATATTCTCGAGAATATGAACCCAACATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009277.3-1985s21c1
Sequence:CCGGGATACCTGTCTACTCCTATATCTCGAGATATAGGAGTAGACAGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009277.3-1131s21c1
Sequence:CCGGTGACAATGAGGAGAGGTTTAGCTCGAGCTAAACCTCTCCTCATTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009277.3-945s21c1
Sequence:CCGGGAACCTGGACACGTTAGATATCTCGAGATATCTAACGTGTCCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009277.3-1421s21c1
Sequence:CCGGTTGTCTCCTTCTACAACATAACTCGAGTTATGTTGTAGAAGGAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040688    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009277.2-2416s1c1
Sequence:CCGGGCCTTGAAGAAAGTGAAATTACTCGAGTAATTTCACTTTCTTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009277.2-584s1c1
Sequence:CCGGGCCGAGAAGATGGAAATGGATCTCGAGATCCATTTCCATCTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009277.2-1499s1c1
Sequence:CCGGCCTCTAAAGCTCTGTCCACTACTCGAGTAGTGGACAGAGCTTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009277.2-319s1c1
Sequence:CCGGGCCCAATAGACATATAGCCAACTCGAGTTGGCTATATGTCTATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009277.2-1334s1c1
Sequence:CCGGCCATGCCAAATTGGGATCTTTCTCGAGAAAGATCCCAATTTGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003141
VALIDATED
TRIM21 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 21
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003141.3-580s21c1
Sequence:CCGGTGGAAGTGGAAATTGCAATAACTCGAGTTATTGCAATTTCCACTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003141.3-1653s21c1
Sequence:CCGGGATCCCAGCAAGCGAGCTTTACTCGAGTAAAGCTCGCTTGCTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003141.3-1077s21c1
Sequence:CCGGGAAGAGAGATTTGATAGTTATCTCGAGATAACTATCAAATCTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003141.3-1001s21c1
Sequence:CCGGCAATCCGTGGCTGATACTTTCCTCGAGGAAAGTATCAGCCACGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003141.3-887s21c1
Sequence:CCGGCCTGAAGGACCTGGATATTACCTCGAGGTAATATCCAGGTCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003141.x-555s1c1
Sequence:CCGGGAGTTGGCTGAGAAGTTGGAACTCGAGTTCCAACTTCTCAGCCAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_003141.x-563s1c1
Sequence:CCGGTGAGAAGTTGGAAGTGGAAATCTCGAGATTTCCACTTCCAACTTCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003141.x-1349s1c1
Sequence:CCGGTGGCATGGTCTCCTTCTACAACTCGAGTTGTAGAAGGAGACCATGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003141.x-1083s1c1
Sequence:CCGGAGTTATCCTATGGTCCTGGGTCTCGAGACCCAGGACCATAGGATAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003141
VALIDATED
TRIM21 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 21
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003141.3-580s21c1
Sequence:CCGGTGGAAGTGGAAATTGCAATAACTCGAGTTATTGCAATTTCCACTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003141.3-1653s21c1
Sequence:CCGGGATCCCAGCAAGCGAGCTTTACTCGAGTAAAGCTCGCTTGCTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003141.3-1077s21c1
Sequence:CCGGGAAGAGAGATTTGATAGTTATCTCGAGATAACTATCAAATCTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003141.3-1001s21c1
Sequence:CCGGCAATCCGTGGCTGATACTTTCCTCGAGGAAAGTATCAGCCACGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003141.3-887s21c1
Sequence:CCGGCCTGAAGGACCTGGATATTACCTCGAGGTAATATCCAGGTCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003141.x-555s1c1
Sequence:CCGGGAGTTGGCTGAGAAGTTGGAACTCGAGTTCCAACTTCTCAGCCAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_003141.x-563s1c1
Sequence:CCGGTGAGAAGTTGGAAGTGGAAATCTCGAGATTTCCACTTCCAACTTCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003141.x-1349s1c1
Sequence:CCGGTGGCATGGTCTCCTTCTACAACTCGAGTTGTAGAAGGAGACCATGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003141.x-1083s1c1
Sequence:CCGGAGTTATCCTATGGTCCTGGGTCTCGAGACCCAGGACCATAGGATAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003141
VALIDATED
TRIM21 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 21
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003141.3-580s21c1
Sequence:CCGGTGGAAGTGGAAATTGCAATAACTCGAGTTATTGCAATTTCCACTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234749    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003141.3-1653s21c1
Sequence:CCGGGATCCCAGCAAGCGAGCTTTACTCGAGTAAAGCTCGCTTGCTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003141.3-1077s21c1
Sequence:CCGGGAAGAGAGATTTGATAGTTATCTCGAGATAACTATCAAATCTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003141.3-1001s21c1
Sequence:CCGGCAATCCGTGGCTGATACTTTCCTCGAGGAAAGTATCAGCCACGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003141.3-887s21c1
Sequence:CCGGCCTGAAGGACCTGGATATTACCTCGAGGTAATATCCAGGTCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003141.x-555s1c1
Sequence:CCGGGAGTTGGCTGAGAAGTTGGAACTCGAGTTCCAACTTCTCAGCCAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_003141.x-563s1c1
Sequence:CCGGTGAGAAGTTGGAAGTGGAAATCTCGAGATTTCCACTTCCAACTTCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003141.x-1349s1c1
Sequence:CCGGTGGCATGGTCTCCTTCTACAACTCGAGTTGTAGAAGGAGACCATGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003141.x-1083s1c1
Sequence:CCGGAGTTATCCTATGGTCCTGGGTCTCGAGACCCAGGACCATAGGATAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks