EMAIL THIS PAGE TO A FRIEND

TRIM23

tripartite motif containing 23

Synonyms: ARD1 ARFD1 RNF46
UniProtKB ID: P36406, Q9BZY4, Q9BZY5
Gene ID:
Human(373) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein is also a member of the ADP ribosylation factor family of guanine nucleotide-binding family of proteins. Its carboxy terminus contains an ADP-ribosylation factor domain and a guanine nucleotide binding site, while the amino terminus contains a GTPase activating protein domain which acts on the guanine nucleotide binding site. The protein localizes to lysosomes and the Golgi apparatus. It plays a role in the formation of intracellular transport vesicles, their movement from one compartment to another, and phopholipase D activation. Three alternatively spliced transcript variants for this gene have been described. [provided by RefSeq, Jul 2008]
Mouse(81003) tripartite motif-containing 23
Rat(81002) tripartite motif-containing 23
Zebrafish(767706) tripartite motif containing 23
dog(487232) tripartite motif containing 23
Horse(100050517) tripartite motif containing 23
domestic cat(101081698) tripartite motif containing 23
chicken(427164) tripartite motif containing 23
naked mole-rat(101714019) tripartite motif containing 23
Domestic Rabbit(100356302) tripartite motif containing 23
domestic guinea pig(100727720) tripartite motif containing 23
cow(537285) tripartite motif containing 23
sheep(101102930) tripartite motif containing 23
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030731 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030731 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030731 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001656 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001656 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001656 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001656 Rosetta Predictions human pricing
NM_033227 Rosetta Predictions human pricing
NM_033228 Rosetta Predictions human pricing
XM_001064021 Rosetta Predictions rat pricing
XM_001064069 Rosetta Predictions rat pricing
XM_342183 Rosetta Predictions rat pricing
NM_030731 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332256 predicted 1313
2 SASI_Hs01_00067128 predicted 1471
3 SASI_Hs01_00067129 predicted 680
4 SASI_Hs01_00067131 predicted 1132
5 SASI_Hs01_00067132 predicted 585
6 SASI_Hs01_00067133 predicted 723
7 SASI_Hs01_00067134 predicted 1046
8 SASI_Hs01_00067135 predicted 920
9 SASI_Hs01_00067137 predicted 1470
10 SASI_Hs02_00332257 predicted 732
11 SASI_Hs01_00067130 predicted 1347
12 SASI_Hs01_00067136 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361032 predicted 1316
2 SASI_Hs01_00243897 predicted 1477
3 SASI_Hs01_00243898 predicted 679
4 SASI_Hs01_00243900 predicted 1136
5 SASI_Hs01_00243901 predicted 583
6 SASI_Hs01_00243902 predicted 723
7 SASI_Hs01_00243903 predicted 1049
8 SASI_Hs01_00243904 predicted 928
9 SASI_Hs01_00243906 predicted 1462
10 SASI_Hs02_00361033 predicted 728
11 SASI_Hs01_00243899 predicted 1343
12 SASI_Hs01_00243905 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361034 predicted 1316
2 SASI_Hs01_00012904 predicted 1473
3 SASI_Hs01_00012905 predicted 683
4 SASI_Hs01_00012907 predicted 1131
5 SASI_Hs01_00012908 predicted 583
6 SASI_Hs01_00012909 predicted 714
7 SASI_Hs01_00012910 predicted 1050
8 SASI_Hs01_00012911 predicted 929
9 SASI_Hs01_00012913 predicted 1463
10 SASI_Hs02_00361035 predicted 729
11 SASI_Hs01_00012906 predicted 1343
12 SASI_Hs01_00012912 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064021 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309055 predicted 752
2 SASI_Rn02_00309056 predicted 1298
3 SASI_Rn02_00309057 predicted 975
4 SASI_Rn02_00309058 predicted 1036
5 SASI_Rn02_00309059 predicted 820
6 SASI_Rn02_00309060 predicted 1194
7 SASI_Rn02_00309061 predicted 1523
8 SASI_Rn02_00309062 predicted 1081
9 SASI_Rn02_00309063 predicted 1291
10 SASI_Rn02_00309064 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064069 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309232 predicted 932
2 SASI_Rn02_00309233 predicted 1478
3 SASI_Rn02_00309234 predicted 1160
4 SASI_Rn02_00309235 predicted 1216
5 SASI_Rn02_00309236 predicted 1003
6 SASI_Rn02_00309237 predicted 813
7 SASI_Rn02_00309238 predicted 1380
8 SASI_Rn02_00309239 predicted 1705
9 SASI_Rn02_00309240 predicted 1261
10 SASI_Rn02_00309241 predicted 1481
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342183 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393873 predicted 939
2 SASI_Rn02_00393874 predicted 1474
3 SASI_Rn02_00393875 predicted 1153
4 SASI_Rn02_00393876 predicted 1215
5 SASI_Rn02_00393877 predicted 1005
6 SASI_Rn02_00393878 predicted 813
7 SASI_Rn02_00393879 predicted 1376
8 SASI_Rn02_00393880 predicted 1710
9 SASI_Rn02_00393881 predicted 1271
10 SASI_Rn02_00393882 predicted 1479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030731 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139603 predicted 3438
2 SASI_Mm01_00139604 predicted 2864
3 SASI_Mm01_00139605 predicted 3696
4 SASI_Mm01_00139606 predicted 3661
5 SASI_Mm01_00139607 predicted 2342
6 SASI_Mm01_00139608 predicted 3067
7 SASI_Mm01_00139609 predicted 3024
8 SASI_Mm01_00139610 predicted 3180
9 SASI_Mm01_00139611 predicted 3670
10 SASI_Mm01_00139612 predicted 2318
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030731
VALIDATED
TRIM23 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 23
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030731.3-3628s21c1
Sequence:CCGGGCAGCAGTTGTTTCATGCTTACTCGAGTAAGCATGAAACAACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030731.3-2748s21c1
Sequence:CCGGCGATCATGTGTCAGAGCTTATCTCGAGATAAGCTCTGACACATGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030731.3-2388s21c1
Sequence:CCGGCGTGTGCCTCTAGCTGATAAACTCGAGTTTATCAGCTAGAGGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030731.3-3405s21c1
Sequence:CCGGCGAGATGCCTTACTCTTGATTCTCGAGAATCAAGAGTAAGGCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030731.3-3110s21c1
Sequence:CCGGCCGAGTAGTCACATTAGGATTCTCGAGAATCCTAATGTGACTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030731.1-3629s1c1
Sequence:CCGGGCAGCAGTTGTTTCATGCTTACTCGAGTAAGCATGAAACAACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030731.1-3111s1c1
Sequence:CCGGCCGAGTAGTCACATTAGGATTCTCGAGAATCCTAATGTGACTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030731.1-3406s1c1
Sequence:CCGGCGAGATGCCTTACTCTTGATTCTCGAGAATCAAGAGTAAGGCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030731.1-2389s1c1
Sequence:CCGGCGTGTGCCTCTAGCTGATAAACTCGAGTTTATCAGCTAGAGGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030731.1-2749s1c1
Sequence:CCGGCGATCATGTGTCAGAGCTTATCTCGAGATAAGCTCTGACACATGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030731
VALIDATED
TRIM23 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 23
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030731.3-3628s21c1
Sequence:CCGGGCAGCAGTTGTTTCATGCTTACTCGAGTAAGCATGAAACAACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030731.3-2748s21c1
Sequence:CCGGCGATCATGTGTCAGAGCTTATCTCGAGATAAGCTCTGACACATGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030731.3-2388s21c1
Sequence:CCGGCGTGTGCCTCTAGCTGATAAACTCGAGTTTATCAGCTAGAGGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030731.3-3405s21c1
Sequence:CCGGCGAGATGCCTTACTCTTGATTCTCGAGAATCAAGAGTAAGGCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030731.3-3110s21c1
Sequence:CCGGCCGAGTAGTCACATTAGGATTCTCGAGAATCCTAATGTGACTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030731.1-3629s1c1
Sequence:CCGGGCAGCAGTTGTTTCATGCTTACTCGAGTAAGCATGAAACAACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030731.1-3111s1c1
Sequence:CCGGCCGAGTAGTCACATTAGGATTCTCGAGAATCCTAATGTGACTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030731.1-3406s1c1
Sequence:CCGGCGAGATGCCTTACTCTTGATTCTCGAGAATCAAGAGTAAGGCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030731.1-2389s1c1
Sequence:CCGGCGTGTGCCTCTAGCTGATAAACTCGAGTTTATCAGCTAGAGGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030731.1-2749s1c1
Sequence:CCGGCGATCATGTGTCAGAGCTTATCTCGAGATAAGCTCTGACACATGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030731
VALIDATED
TRIM23 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 23
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030731.3-3628s21c1
Sequence:CCGGGCAGCAGTTGTTTCATGCTTACTCGAGTAAGCATGAAACAACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030731.3-2748s21c1
Sequence:CCGGCGATCATGTGTCAGAGCTTATCTCGAGATAAGCTCTGACACATGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030731.3-2388s21c1
Sequence:CCGGCGTGTGCCTCTAGCTGATAAACTCGAGTTTATCAGCTAGAGGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030731.3-3405s21c1
Sequence:CCGGCGAGATGCCTTACTCTTGATTCTCGAGAATCAAGAGTAAGGCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030731.3-3110s21c1
Sequence:CCGGCCGAGTAGTCACATTAGGATTCTCGAGAATCCTAATGTGACTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030731.1-3629s1c1
Sequence:CCGGGCAGCAGTTGTTTCATGCTTACTCGAGTAAGCATGAAACAACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030731.1-3111s1c1
Sequence:CCGGCCGAGTAGTCACATTAGGATTCTCGAGAATCCTAATGTGACTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030731.1-3406s1c1
Sequence:CCGGCGAGATGCCTTACTCTTGATTCTCGAGAATCAAGAGTAAGGCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030731.1-2389s1c1
Sequence:CCGGCGTGTGCCTCTAGCTGATAAACTCGAGTTTATCAGCTAGAGGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030731.1-2749s1c1
Sequence:CCGGCGATCATGTGTCAGAGCTTATCTCGAGATAAGCTCTGACACATGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001656
VALIDATED
TRIM23 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 23
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001656.3-2980s21c1
Sequence:CCGGTATTATGGAAGCACGATTTATCTCGAGATAAATCGTGCTTCCATAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001656.3-1695s21c1
Sequence:CCGGTGTGGCCGTAGCTGGTATATTCTCGAGAATATACCAGCTACGGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001656.3-1670s21c1
Sequence:CCGGACTACTCAGTCTCCATAAATTCTCGAGAATTTATGGAGACTGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_001656.3-941s21c1
Sequence:CCGGGTCATGTATTCGAGCTTATTTCTCGAGAAATAAGCTCGAATACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001656.3-578s21c1
Sequence:CCGGGCGAGTTCCTCTAGCTGATAACTCGAGTTATCAGCTAGAGGAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001656.3-655s1c1
Sequence:CCGGGCTTGGAAGAAGGTTGTCAAACTCGAGTTTGACAACCTTCTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001656.3-1731s1c1
Sequence:CCGGCGAAGTGGTATGGGACTGTATCTCGAGATACAGTCCCATACCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001656.3-301s1c1
Sequence:CCGGGCCCATTTGATCGACAAGTAACTCGAGTTACTTGTCGATCAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001656.3-1528s1c1
Sequence:CCGGGCAGTCATAGAGACAGAATTACTCGAGTAATTCTGTCTCTATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001656
VALIDATED
TRIM23 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 23
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001656.3-2980s21c1
Sequence:CCGGTATTATGGAAGCACGATTTATCTCGAGATAAATCGTGCTTCCATAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001656.3-1695s21c1
Sequence:CCGGTGTGGCCGTAGCTGGTATATTCTCGAGAATATACCAGCTACGGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001656.3-1670s21c1
Sequence:CCGGACTACTCAGTCTCCATAAATTCTCGAGAATTTATGGAGACTGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_001656.3-941s21c1
Sequence:CCGGGTCATGTATTCGAGCTTATTTCTCGAGAAATAAGCTCGAATACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001656.3-578s21c1
Sequence:CCGGGCGAGTTCCTCTAGCTGATAACTCGAGTTATCAGCTAGAGGAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001656.3-655s1c1
Sequence:CCGGGCTTGGAAGAAGGTTGTCAAACTCGAGTTTGACAACCTTCTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001656.3-1731s1c1
Sequence:CCGGCGAAGTGGTATGGGACTGTATCTCGAGATACAGTCCCATACCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001656.3-301s1c1
Sequence:CCGGGCCCATTTGATCGACAAGTAACTCGAGTTACTTGTCGATCAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001656.3-1528s1c1
Sequence:CCGGGCAGTCATAGAGACAGAATTACTCGAGTAATTCTGTCTCTATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001656
VALIDATED
TRIM23 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 23
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001656.3-2980s21c1
Sequence:CCGGTATTATGGAAGCACGATTTATCTCGAGATAAATCGTGCTTCCATAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001656.3-1695s21c1
Sequence:CCGGTGTGGCCGTAGCTGGTATATTCTCGAGAATATACCAGCTACGGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001656.3-1670s21c1
Sequence:CCGGACTACTCAGTCTCCATAAATTCTCGAGAATTTATGGAGACTGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_001656.3-941s21c1
Sequence:CCGGGTCATGTATTCGAGCTTATTTCTCGAGAAATAAGCTCGAATACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001656.3-578s21c1
Sequence:CCGGGCGAGTTCCTCTAGCTGATAACTCGAGTTATCAGCTAGAGGAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001656.3-655s1c1
Sequence:CCGGGCTTGGAAGAAGGTTGTCAAACTCGAGTTTGACAACCTTCTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001656.3-1731s1c1
Sequence:CCGGCGAAGTGGTATGGGACTGTATCTCGAGATACAGTCCCATACCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001656.3-301s1c1
Sequence:CCGGGCCCATTTGATCGACAAGTAACTCGAGTTACTTGTCGATCAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001656.3-1528s1c1
Sequence:CCGGGCAGTCATAGAGACAGAATTACTCGAGTAATTCTGTCTCTATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks