EMAIL THIS PAGE TO A FRIEND

TRIM24

tripartite motif containing 24

Synonyms: PTC6 RNF82 TF1A TIF1 TIF1A TIF1ALPHA hTIF1
UniProtKB ID: O15164, A4D1R7, A4D1R8, O95854
Gene ID:
Human(8805) Summary: The protein encoded by this gene mediates transcriptional control by interaction with the activation function 2 (AF2) region of several nuclear receptors, including the estrogen, retinoic acid, and vitamin D3 receptors. The protein localizes to nuclear bodies and is thought to associate with chromatin and heterochromatin-associated factors. The protein is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains - a RING, a B-box type 1 and a B-box type 2 - and a coiled-coil region. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(21848) tripartite motif-containing 24
Rat(500084) tripartite motif-containing 24
cow(537246) tripartite motif containing 24
sheep(101109010) tripartite motif containing 24
domestic guinea pig(100721356) tripartite motif containing 24
Domestic Rabbit(100348283) tripartite motif containing 24
naked mole-rat(101717311) tripartite motif containing 24
Zebrafish(442869) tripartite motif-containing 24
Horse(100066810) tripartite motif containing 24
domestic cat(101089090) tripartite motif containing 24
chicken(418106) tripartite motif containing 24
120 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501904 Anti-TRIM24 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, human
ELISA, immunohistochemistry pricing
SAB2102545 Anti-TRIM24 antibody produced in rabbit affinity isolated antibody mouse, guinea pig, rabbit, rat, human, horse
western blot pricing
SAB2104370 Anti-TRIM24 antibody produced in rabbit affinity isolated antibody mouse, rat, horse, human, guinea pig, rabbit
western blot pricing
HPA043495 Anti-TRIM24 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1411568 Anti-TRIM24 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA061717 Anti-TRIM24 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB4503475 Anti-TRIM24, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
WH0008805M1 Monoclonal Anti-TRIM24 antibody produced in mouse clone 2F2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PLA0147 Rabbit anti-TIF1 Alpha/TRIM24 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. bovine, mouse, human, rhesus monkey, rat, horse, chimpanzee, gorilla, dog, primate, guinea pig, rabbit
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003852 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003852 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003852 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145076 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145076 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145076 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003852 Rosetta Predictions human pricing
NM_015905 Rosetta Predictions human pricing
NM_001044266 Rosetta Predictions rat pricing
NM_145076 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043210 predicted 1133
2 SASI_Hs01_00043211 predicted 782
3 SASI_Hs01_00043212 predicted 622
4 SASI_Hs01_00043213 predicted 2894
5 SASI_Hs01_00043214 predicted 2935
6 SASI_Hs01_00043215 predicted 1222
7 SASI_Hs01_00043216 predicted 1009
8 SASI_Hs01_00043217 predicted 2795
9 SASI_Hs01_00043218 predicted 1895
10 SASI_Hs02_00336429 predicted 2537
11 SASI_Hs01_00043209 predicted 984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348498 predicted 1129
2 SASI_Hs01_00057286 predicted 782
3 SASI_Hs01_00057287 predicted 624
4 SASI_Hs01_00057288 predicted 3001
5 SASI_Hs01_00057290 predicted 3037
6 SASI_Hs02_00348499 predicted 1222
7 SASI_Hs02_00348500 predicted 1008
8 SASI_Hs01_00057291 predicted 2894
9 SASI_Hs01_00057294 predicted 1999
10 SASI_Hs01_00057295 predicted 2639
11 SASI_Hs01_00057289 predicted 2614
12 SASI_Hs01_00057292 predicted 2475
13 SASI_Hs01_00057293 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044266 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205334 predicted 1497
2 SASI_Rn02_00205335 predicted 1780
3 SASI_Rn02_00205336 predicted 619
4 SASI_Rn02_00205337 predicted 1093
5 SASI_Rn02_00205338 predicted 725
6 SASI_Rn02_00205339 predicted 1507
7 SASI_Rn02_00205340 predicted 2126
8 SASI_Rn02_00205341 predicted 1535
9 SASI_Rn02_00205342 predicted 1342
10 SASI_Rn02_00205343 predicted 2267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145076 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084205 predicted 1639
2 SASI_Mm01_00084206 predicted 1649
3 SASI_Mm01_00084207 predicted 3156
4 SASI_Mm01_00084208 predicted 1724
5 SASI_Mm01_00084209 predicted 3123
6 SASI_Mm01_00084210 predicted 1710
7 SASI_Mm01_00084211 predicted 1307
8 SASI_Mm01_00084212 predicted 1673
9 SASI_Mm01_00084213 predicted 2422
10 SASI_Mm01_00084214 predicted 1696
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003852
VALIDATED
TRIM24 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 24
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003852.2-1128s1c1
Sequence:CCGGCGCATGAAACTTATGCAACAACTCGAGTTGTTGCATAAGTTTCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003852.2-2762s1c1
Sequence:CCGGCCATGAAATGAGCCTGGCTTTCTCGAGAAAGCCAGGCTCATTTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003852.2-1222s1c1
Sequence:CCGGGCAGCAGTACAGCATTACTTTCTCGAGAAAGTAATGCTGTACTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003852.2-2622s1c1
Sequence:CCGGCGAGACTTATCTAAACCAGAACTCGAGTTCTGGTTTAGATAAGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003852.2-2217s1c1
Sequence:CCGGCCTGTTGTTATAGTGAAGCAACTCGAGTTGCTTCACTATAACAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003852.3-1353s1c1
Sequence:CCGGCGACTGATTACATACCGGTTACTCGAGTAACCGGTATGTAATCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003852.3-2801s1c1
Sequence:CCGGCCTTGTTAAGTTAACACCTATCTCGAGATAGGTGTTAACTTAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194983    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003852.3-3418s1c1
Sequence:CCGGCCATTTCTGTTAACCTCTTATCTCGAGATAAGAGGTTAACAGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003852.3-1230s21c1
Sequence:CCGGCGCATGAAACTTATGCAACAACTCGAGTTGTTGCATAAGTTTCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003852.3-2319s21c1
Sequence:CCGGCCTGTTGTTATAGTGAAGCAACTCGAGTTGCTTCACTATAACAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003852.3-1324s21c1
Sequence:CCGGGCAGCAGTACAGCATTACTTTCTCGAGAAAGTAATGCTGTACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003852.3-2864s21c1
Sequence:CCGGCCATGAAATGAGCCTGGCTTTCTCGAGAAAGCCAGGCTCATTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003852
VALIDATED
TRIM24 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 24
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003852.2-1128s1c1
Sequence:CCGGCGCATGAAACTTATGCAACAACTCGAGTTGTTGCATAAGTTTCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003852.2-2762s1c1
Sequence:CCGGCCATGAAATGAGCCTGGCTTTCTCGAGAAAGCCAGGCTCATTTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003852.2-1222s1c1
Sequence:CCGGGCAGCAGTACAGCATTACTTTCTCGAGAAAGTAATGCTGTACTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003852.2-2622s1c1
Sequence:CCGGCGAGACTTATCTAAACCAGAACTCGAGTTCTGGTTTAGATAAGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003852.2-2217s1c1
Sequence:CCGGCCTGTTGTTATAGTGAAGCAACTCGAGTTGCTTCACTATAACAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003852.3-1353s1c1
Sequence:CCGGCGACTGATTACATACCGGTTACTCGAGTAACCGGTATGTAATCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003852.3-2801s1c1
Sequence:CCGGCCTTGTTAAGTTAACACCTATCTCGAGATAGGTGTTAACTTAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194983    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003852.3-3418s1c1
Sequence:CCGGCCATTTCTGTTAACCTCTTATCTCGAGATAAGAGGTTAACAGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003852.3-1230s21c1
Sequence:CCGGCGCATGAAACTTATGCAACAACTCGAGTTGTTGCATAAGTTTCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003852.3-2319s21c1
Sequence:CCGGCCTGTTGTTATAGTGAAGCAACTCGAGTTGCTTCACTATAACAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003852.3-1324s21c1
Sequence:CCGGGCAGCAGTACAGCATTACTTTCTCGAGAAAGTAATGCTGTACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003852.3-2864s21c1
Sequence:CCGGCCATGAAATGAGCCTGGCTTTCTCGAGAAAGCCAGGCTCATTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003852
VALIDATED
TRIM24 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 24
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003852.2-1128s1c1
Sequence:CCGGCGCATGAAACTTATGCAACAACTCGAGTTGTTGCATAAGTTTCATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003852.2-2762s1c1
Sequence:CCGGCCATGAAATGAGCCTGGCTTTCTCGAGAAAGCCAGGCTCATTTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003852.2-1222s1c1
Sequence:CCGGGCAGCAGTACAGCATTACTTTCTCGAGAAAGTAATGCTGTACTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003852.2-2622s1c1
Sequence:CCGGCGAGACTTATCTAAACCAGAACTCGAGTTCTGGTTTAGATAAGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003852.2-2217s1c1
Sequence:CCGGCCTGTTGTTATAGTGAAGCAACTCGAGTTGCTTCACTATAACAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003852.3-1353s1c1
Sequence:CCGGCGACTGATTACATACCGGTTACTCGAGTAACCGGTATGTAATCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003852.3-2801s1c1
Sequence:CCGGCCTTGTTAAGTTAACACCTATCTCGAGATAGGTGTTAACTTAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194983    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003852.3-3418s1c1
Sequence:CCGGCCATTTCTGTTAACCTCTTATCTCGAGATAAGAGGTTAACAGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003852.3-1230s21c1
Sequence:CCGGCGCATGAAACTTATGCAACAACTCGAGTTGTTGCATAAGTTTCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003852.3-2319s21c1
Sequence:CCGGCCTGTTGTTATAGTGAAGCAACTCGAGTTGCTTCACTATAACAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003852.3-1324s21c1
Sequence:CCGGGCAGCAGTACAGCATTACTTTCTCGAGAAAGTAATGCTGTACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003852.3-2864s21c1
Sequence:CCGGCCATGAAATGAGCCTGGCTTTCTCGAGAAAGCCAGGCTCATTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145076
VALIDATED
TRIM24 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 24
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145076.1-3476s1c1
Sequence:CCGGGCTGTGCTAGAGATTTCTCATCTCGAGATGAGAAATCTCTAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145076.1-2273s1c1
Sequence:CCGGCGGTGCAGTCACCAAATTCATCTCGAGATGAATTTGGTGACTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145076.1-1837s1c1
Sequence:CCGGCCACCACGCTTAATAAACTTTCTCGAGAAAGTTTATTAAGCGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145076.1-3088s1c1
Sequence:CCGGCCTCTAACTGTGCCTGATTATCTCGAGATAATCAGGCACAGTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145076.1-659s1c1
Sequence:CCGGCCCAAGTTGGAGTCATTCGATCTCGAGATCGAATGACTCCAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145076.3-2273s21c1
Sequence:CCGGCGGTGCAGTCACCAAATTCATCTCGAGATGAATTTGGTGACTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145076.3-3476s21c1
Sequence:CCGGGCTGTGCTAGAGATTTCTCATCTCGAGATGAGAAATCTCTAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145076.3-659s21c1
Sequence:CCGGCCCAAGTTGGAGTCATTCGATCTCGAGATCGAATGACTCCAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145076.3-1837s21c1
Sequence:CCGGCCACCACGCTTAATAAACTTTCTCGAGAAAGTTTATTAAGCGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145076.3-1101s21c1
Sequence:CCGGAGTGATCATAGATACTCTAATCTCGAGATTAGAGTATCTATGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145076
VALIDATED
TRIM24 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 24
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145076.1-3476s1c1
Sequence:CCGGGCTGTGCTAGAGATTTCTCATCTCGAGATGAGAAATCTCTAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145076.1-2273s1c1
Sequence:CCGGCGGTGCAGTCACCAAATTCATCTCGAGATGAATTTGGTGACTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145076.1-1837s1c1
Sequence:CCGGCCACCACGCTTAATAAACTTTCTCGAGAAAGTTTATTAAGCGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145076.1-3088s1c1
Sequence:CCGGCCTCTAACTGTGCCTGATTATCTCGAGATAATCAGGCACAGTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145076.1-659s1c1
Sequence:CCGGCCCAAGTTGGAGTCATTCGATCTCGAGATCGAATGACTCCAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145076.3-2273s21c1
Sequence:CCGGCGGTGCAGTCACCAAATTCATCTCGAGATGAATTTGGTGACTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145076.3-3476s21c1
Sequence:CCGGGCTGTGCTAGAGATTTCTCATCTCGAGATGAGAAATCTCTAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145076.3-659s21c1
Sequence:CCGGCCCAAGTTGGAGTCATTCGATCTCGAGATCGAATGACTCCAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145076.3-1837s21c1
Sequence:CCGGCCACCACGCTTAATAAACTTTCTCGAGAAAGTTTATTAAGCGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145076.3-1101s21c1
Sequence:CCGGAGTGATCATAGATACTCTAATCTCGAGATTAGAGTATCTATGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145076
VALIDATED
TRIM24 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 24
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145076.1-3476s1c1
Sequence:CCGGGCTGTGCTAGAGATTTCTCATCTCGAGATGAGAAATCTCTAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145076.1-2273s1c1
Sequence:CCGGCGGTGCAGTCACCAAATTCATCTCGAGATGAATTTGGTGACTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145076.1-1837s1c1
Sequence:CCGGCCACCACGCTTAATAAACTTTCTCGAGAAAGTTTATTAAGCGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145076.1-3088s1c1
Sequence:CCGGCCTCTAACTGTGCCTGATTATCTCGAGATAATCAGGCACAGTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145076.1-659s1c1
Sequence:CCGGCCCAAGTTGGAGTCATTCGATCTCGAGATCGAATGACTCCAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145076.3-2273s21c1
Sequence:CCGGCGGTGCAGTCACCAAATTCATCTCGAGATGAATTTGGTGACTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288035    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145076.3-3476s21c1
Sequence:CCGGGCTGTGCTAGAGATTTCTCATCTCGAGATGAGAAATCTCTAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145076.3-659s21c1
Sequence:CCGGCCCAAGTTGGAGTCATTCGATCTCGAGATCGAATGACTCCAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145076.3-1837s21c1
Sequence:CCGGCCACCACGCTTAATAAACTTTCTCGAGAAAGTTTATTAAGCGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145076.3-1101s21c1
Sequence:CCGGAGTGATCATAGATACTCTAATCTCGAGATTAGAGTATCTATGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks