EMAIL THIS PAGE TO A FRIEND

TRIM25

tripartite motif containing 25

Synonyms: EFP RNF147 Z147 ZNF147
UniProtKB ID: Q14258
Gene ID:
Human(7706) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to the cytoplasm. The presence of potential DNA-binding and dimerization-transactivation domains suggests that this protein may act as a transcription factor, similar to several other members of the TRIM family. Expression of the gene is upregulated in response to estrogen, and it is thought to mediate estrogen actions in breast cancer as a primary response gene. [provided by RefSeq, Jul 2008]
Mouse(217069) tripartite motif-containing 25
Rat(494338) tripartite motif-containing 25
Zebrafish(393144) tripartite motif-containing 25
domestic cat(101084663) tripartite motif containing 25
Horse(100146440) tripartite motif containing 25
dog(491103) tripartite motif containing 25
chicken(417401) tripartite motif containing 25
naked mole-rat(101710143) tripartite motif containing 25
domestic guinea pig(100727761) tripartite motif containing 25
cow(510923) tripartite motif containing 25
sheep(101122873) tripartite motif containing 25
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
T0454 Anti-TRIM25 (366-380) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
T0579 Anti-TRIM25 (481-495) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1406620 Anti-TRIM25 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1412628 ANTI-TRIM25 antibody produced in mouse clone 5F12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA005909 Anti-TRIM25 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB3500382 Anti-TRIM25 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
SAB4503124 Anti-ZNF147 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
WH0007706M1 Monoclonal Anti-TRIM25 antibody produced in mouse clone 2B12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404551 Monoclonal Anti-TRIM25 antibody produced in mouse clone 5C3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005082 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005082 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005082 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009546 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009546 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009546 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005082 Rosetta Predictions human pricing
NM_001009536 Rosetta Predictions rat pricing
NM_009546 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005082 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123160 predicted 880
2 SASI_Hs01_00123162 predicted 873
3 SASI_Hs02_00338928 predicted 404
4 SASI_Hs01_00123163 predicted 849
5 SASI_Hs01_00123164 predicted 673
6 SASI_Hs02_00338929 predicted 1340
7 SASI_Hs02_00338930 predicted 806
8 SASI_Hs01_00123165 predicted 528
9 SASI_Hs01_00123166 predicted 665
10 SASI_Hs01_00123167 predicted 862
11 SASI_Hs01_00123159 predicted 526
12 SASI_Hs01_00123161 predicted 1201
13 SASI_Hs01_00123168 predicted 1011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009536 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199594 predicted 677
2 SASI_Rn02_00199595 predicted 847
3 SASI_Rn01_00040601 predicted 1018
4 SASI_Rn01_00040603 predicted 918
5 SASI_Rn01_00040604 predicted 1836
6 SASI_Rn01_00040606 predicted 583
7 SASI_Rn01_00040607 predicted 690
8 SASI_Rn01_00040608 predicted 513
9 SASI_Rn01_00040609 predicted 860
10 SASI_Rn01_00040610 predicted 803
11 SASI_Rn01_00040602 predicted 654
12 SASI_Rn01_00040605 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009546 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111500 predicted 1060
2 SASI_Mm01_00111501 predicted 682
3 SASI_Mm01_00111502 predicted 906
4 SASI_Mm01_00111504 predicted 1466
5 SASI_Mm02_00316384 predicted 878
6 SASI_Mm02_00316385 predicted 675
7 SASI_Mm02_00316386 predicted 1294
8 SASI_Mm02_00316387 predicted 2031
9 SASI_Mm02_00316388 predicted 1614
10 SASI_Mm01_00111506 predicted 1116
11 SASI_Mm01_00111503 predicted 1218
12 SASI_Mm01_00111505 predicted 1426
13 SASI_Mm01_00111507 predicted 1147
14 SASI_Mm01_00111508 predicted 999
15 SASI_Mm01_00111509 predicted 970
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005082
VALIDATED
TRIM25 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 25
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005082.4-1285s21c1
Sequence:CCGGCCGGAACAGTTAGTGGATTTACTCGAGTAAATCCACTAACTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005082.4-1731s21c1
Sequence:CCGGGATCTCTGCCTGGCACAATAACTCGAGTTATTGTGCCAGGCAGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005082.4-915s21c1
Sequence:CCGGGAGTGAGATCCAGACCTTGAACTCGAGTTCAAGGTCTGGATCTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005082.4-2259s21c1
Sequence:CCGGGTGCCCGATTCCTCTTAGAGACTCGAGTCTCTAAGAGGAATCGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005082.4-1042s21c1
Sequence:CCGGGAACTGAACCACAAGCTGATACTCGAGTATCAGCTTGTGGTTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005082.x-915s1c1
Sequence:CCGGGAGTGAGATCCAGACCTTGAACTCGAGTTCAAGGTCTGGATCTCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005082.x-1340s1c1
Sequence:CCGGCCAGCTCACATCCGAACTCAACTCGAGTTGAGTTCGGATGTGAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005082.x-2261s1c1
Sequence:CCGGGTGCCCGATTCCTCTTAGAGACTCGAGTCTCTAAGAGGAATCGGGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005082.x-1042s1c1
Sequence:CCGGGAACTGAACCACAAGCTGATACTCGAGTATCAGCTTGTGGTTCAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005082
VALIDATED
TRIM25 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 25
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005082.4-1285s21c1
Sequence:CCGGCCGGAACAGTTAGTGGATTTACTCGAGTAAATCCACTAACTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005082.4-1731s21c1
Sequence:CCGGGATCTCTGCCTGGCACAATAACTCGAGTTATTGTGCCAGGCAGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005082.4-915s21c1
Sequence:CCGGGAGTGAGATCCAGACCTTGAACTCGAGTTCAAGGTCTGGATCTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005082.4-2259s21c1
Sequence:CCGGGTGCCCGATTCCTCTTAGAGACTCGAGTCTCTAAGAGGAATCGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005082.4-1042s21c1
Sequence:CCGGGAACTGAACCACAAGCTGATACTCGAGTATCAGCTTGTGGTTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005082.x-915s1c1
Sequence:CCGGGAGTGAGATCCAGACCTTGAACTCGAGTTCAAGGTCTGGATCTCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005082.x-1340s1c1
Sequence:CCGGCCAGCTCACATCCGAACTCAACTCGAGTTGAGTTCGGATGTGAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005082.x-2261s1c1
Sequence:CCGGGTGCCCGATTCCTCTTAGAGACTCGAGTCTCTAAGAGGAATCGGGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005082.x-1042s1c1
Sequence:CCGGGAACTGAACCACAAGCTGATACTCGAGTATCAGCTTGTGGTTCAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005082
VALIDATED
TRIM25 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 25
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005082.4-1285s21c1
Sequence:CCGGCCGGAACAGTTAGTGGATTTACTCGAGTAAATCCACTAACTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005082.4-1731s21c1
Sequence:CCGGGATCTCTGCCTGGCACAATAACTCGAGTTATTGTGCCAGGCAGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005082.4-915s21c1
Sequence:CCGGGAGTGAGATCCAGACCTTGAACTCGAGTTCAAGGTCTGGATCTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005082.4-2259s21c1
Sequence:CCGGGTGCCCGATTCCTCTTAGAGACTCGAGTCTCTAAGAGGAATCGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005082.4-1042s21c1
Sequence:CCGGGAACTGAACCACAAGCTGATACTCGAGTATCAGCTTGTGGTTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005082.x-915s1c1
Sequence:CCGGGAGTGAGATCCAGACCTTGAACTCGAGTTCAAGGTCTGGATCTCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005082.x-1340s1c1
Sequence:CCGGCCAGCTCACATCCGAACTCAACTCGAGTTGAGTTCGGATGTGAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005082.x-2261s1c1
Sequence:CCGGGTGCCCGATTCCTCTTAGAGACTCGAGTCTCTAAGAGGAATCGGGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005082.x-1042s1c1
Sequence:CCGGGAACTGAACCACAAGCTGATACTCGAGTATCAGCTTGTGGTTCAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009546
VALIDATED
TRIM25 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 25
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009546.2-1849s21c1
Sequence:CCGGGTGACCACGGCTTCGTCATTTCTCGAGAAATGACGAAGCCGTGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009546.2-5234s21c1
Sequence:CCGGTGCCTGACACAGCGGAATTTACTCGAGTAAATTCCGCTGTGTCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009546.2-853s21c1
Sequence:CCGGCCAGCTCCTTGCGCAAGTTAACTCGAGTTAACTTGCGCAAGGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009546.2-801s21c1
Sequence:CCGGCAGCTGAGACAGGAGTATATGCTCGAGCATATACTCCTGTCTCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009546.1-1392s1c1
Sequence:CCGGCGTGAAAGTCATCTTCGACTACTCGAGTAGTCGAAGATGACTTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009546.1-597s1c1
Sequence:CCGGCCTGGAGTACAAACTGAGGAACTCGAGTTCCTCAGTTTGTACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009546.1-468s1c1
Sequence:CCGGCCGCAAATGTACCCAGCACAACTCGAGTTGTGCTGGGTACATTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009546.1-1537s1c1
Sequence:CCGGCACTGCTACAAGAATGGCATTCTCGAGAATGCCATTCTTGTAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009546.1-979s1c1
Sequence:CCGGCCTAAGATAGATCTGGATCATCTCGAGATGATCCAGATCTATCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009546
VALIDATED
TRIM25 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 25
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009546.2-1849s21c1
Sequence:CCGGGTGACCACGGCTTCGTCATTTCTCGAGAAATGACGAAGCCGTGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009546.2-5234s21c1
Sequence:CCGGTGCCTGACACAGCGGAATTTACTCGAGTAAATTCCGCTGTGTCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009546.2-853s21c1
Sequence:CCGGCCAGCTCCTTGCGCAAGTTAACTCGAGTTAACTTGCGCAAGGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009546.2-801s21c1
Sequence:CCGGCAGCTGAGACAGGAGTATATGCTCGAGCATATACTCCTGTCTCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009546.1-1392s1c1
Sequence:CCGGCGTGAAAGTCATCTTCGACTACTCGAGTAGTCGAAGATGACTTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009546.1-597s1c1
Sequence:CCGGCCTGGAGTACAAACTGAGGAACTCGAGTTCCTCAGTTTGTACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009546.1-468s1c1
Sequence:CCGGCCGCAAATGTACCCAGCACAACTCGAGTTGTGCTGGGTACATTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009546.1-1537s1c1
Sequence:CCGGCACTGCTACAAGAATGGCATTCTCGAGAATGCCATTCTTGTAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009546.1-979s1c1
Sequence:CCGGCCTAAGATAGATCTGGATCATCTCGAGATGATCCAGATCTATCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009546
VALIDATED
TRIM25 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 25
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009546.2-1849s21c1
Sequence:CCGGGTGACCACGGCTTCGTCATTTCTCGAGAAATGACGAAGCCGTGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009546.2-5234s21c1
Sequence:CCGGTGCCTGACACAGCGGAATTTACTCGAGTAAATTCCGCTGTGTCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009546.2-853s21c1
Sequence:CCGGCCAGCTCCTTGCGCAAGTTAACTCGAGTTAACTTGCGCAAGGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009546.2-801s21c1
Sequence:CCGGCAGCTGAGACAGGAGTATATGCTCGAGCATATACTCCTGTCTCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009546.1-1392s1c1
Sequence:CCGGCGTGAAAGTCATCTTCGACTACTCGAGTAGTCGAAGATGACTTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009546.1-597s1c1
Sequence:CCGGCCTGGAGTACAAACTGAGGAACTCGAGTTCCTCAGTTTGTACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009546.1-468s1c1
Sequence:CCGGCCGCAAATGTACCCAGCACAACTCGAGTTGTGCTGGGTACATTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009546.1-1537s1c1
Sequence:CCGGCACTGCTACAAGAATGGCATTCTCGAGAATGCCATTCTTGTAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009546.1-979s1c1
Sequence:CCGGCCTAAGATAGATCTGGATCATCTCGAGATGATCCAGATCTATCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks