EMAIL THIS PAGE TO A FRIEND

TRIM26

tripartite motif containing 26

Synonyms: AFP RNF95 ZNF173
UniProtKB ID: Q12899, A6NG96, Q5SRL2
Gene ID:
Human(7726) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Although the function of the protein is unknown, the RING domain suggests that the protein may have DNA-binding activity. The gene localizes to the major histocompatibility complex (MHC) class I region on chromosome 6. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2011]
Mouse(22670) tripartite motif-containing 26
Rat(309586) tripartite motif-containing 26
dog(488347) tripartite motif containing 26
Horse(100051726) tripartite motif containing 26
domestic cat(101096649) tripartite motif containing 26
cow(538544) tripartite motif-containing 26
cow(785873) tripartite motif containing 26
sheep(101111496) tripartite motif containing 26
naked mole-rat(101714616) tripartite motif containing 26
Domestic Rabbit(100354871) tripartite motif containing 26
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030698 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030698 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030698 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003449 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003449 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003449 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025599 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025599 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025599 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003449 Rosetta Predictions human pricing
NM_001011665 Rosetta Predictions rat pricing
XM_574717 Rosetta Predictions rat pricing
NM_001025599 Rosetta Predictions mouse pricing
NM_030698 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025275 predicted 2426
2 SASI_Hs01_00025276 predicted 2357
3 SASI_Hs01_00025277 predicted 607
4 SASI_Hs01_00025280 predicted 2220
5 SASI_Hs01_00025281 predicted 636
6 SASI_Hs01_00025282 predicted 1966
7 SASI_Hs01_00025283 predicted 2549
8 SASI_Hs01_00025284 predicted 1958
9 SASI_Hs02_00335679 predicted 959
10 SASI_Hs02_00335680 predicted 2309
11 SASI_Hs01_00025278 predicted 2542
12 SASI_Hs01_00025279 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011665 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082916 predicted 745
2 SASI_Rn01_00082917 predicted 1847
3 SASI_Rn01_00082918 predicted 839
4 SASI_Rn01_00082920 predicted 509
5 SASI_Rn01_00082921 predicted 533
6 SASI_Rn01_00082922 predicted 650
7 SASI_Rn01_00082923 predicted 789
8 SASI_Rn01_00082924 predicted 1842
9 SASI_Rn01_00082925 predicted 400
10 SASI_Rn02_00199848 predicted 976
11 SASI_Rn01_00082919 predicted 1857
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574717 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00135016 predicted 337
2 SASI_Rn01_00135017 predicted 523
3 SASI_Rn01_00135018 predicted 506
4 SASI_Rn01_00135019 predicted 339
5 SASI_Rn01_00135020 predicted 515
6 SASI_Rn01_00135021 predicted 501
7 SASI_Rn01_00135022 predicted 361
8 SASI_Rn01_00135023 predicted 343
9 SASI_Rn01_00135024 predicted 217
10 SASI_Rn01_00135025 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121792 predicted 776
2 SASI_Mm02_00287955 predicted 2148
3 SASI_Mm01_00121793 predicted 758
4 SASI_Mm02_00287956 predicted 2113
5 SASI_Mm02_00287957 predicted 1962
6 SASI_Mm01_00121794 predicted 590
7 SASI_Mm02_00287958 predicted 814
8 SASI_Mm02_00287959 predicted 1060
9 SASI_Mm02_00287960 predicted 1808
10 SASI_Mm02_00287961 predicted 477
11 SASI_Mm01_00121791 predicted 1008
12 SASI_Mm01_00121795 predicted 606
13 SASI_Mm01_00121796 predicted 773
14 SASI_Mm01_00121797 predicted 660
15 SASI_Mm01_00121798 predicted 763
16 SASI_Mm01_00121799 predicted 915
17 SASI_Mm01_00121800 predicted 1015
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030698 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036931 predicted 1004
2 SASI_Mm01_00036932 predicted 963
3 SASI_Mm01_00036933 predicted 943
4 SASI_Mm01_00036934 predicted 779
5 SASI_Mm01_00036935 predicted 606
6 SASI_Mm01_00036936 predicted 774
7 SASI_Mm01_00036937 predicted 660
8 SASI_Mm01_00036938 predicted 763
9 SASI_Mm01_00036939 predicted 919
10 SASI_Mm01_00036940 predicted 1008
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030698
VALIDATED
TRIM26 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 26
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030698.4-1007s1c1
Sequence:CCGGGCAGTACATTGTGGCGGAATTCTCGAGAATTCCGCCACAATGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030698.4-1290s1c1
Sequence:CCGGGCCATCCCTCACATGGTTAAACTCGAGTTTAACCATGTGAGGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030698.4-954s1c1
Sequence:CCGGGCCAAGGGAGAAGCTGATATTCTCGAGAATATCAGCTTCTCCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030698.4-767s1c1
Sequence:CCGGCCAGGAGAAGCTACACTACTACTCGAGTAGTAGTGTAGCTTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030698.4-1391s1c1
Sequence:CCGGCTTGGAGTATAAGACAGATTTCTCGAGAAATCTGTCTTATACTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030698
VALIDATED
TRIM26 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 26
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030698.4-1007s1c1
Sequence:CCGGGCAGTACATTGTGGCGGAATTCTCGAGAATTCCGCCACAATGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030698.4-1290s1c1
Sequence:CCGGGCCATCCCTCACATGGTTAAACTCGAGTTTAACCATGTGAGGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030698.4-954s1c1
Sequence:CCGGGCCAAGGGAGAAGCTGATATTCTCGAGAATATCAGCTTCTCCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030698.4-767s1c1
Sequence:CCGGCCAGGAGAAGCTACACTACTACTCGAGTAGTAGTGTAGCTTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030698.4-1391s1c1
Sequence:CCGGCTTGGAGTATAAGACAGATTTCTCGAGAAATCTGTCTTATACTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030698
VALIDATED
TRIM26 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 26
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030698.4-1007s1c1
Sequence:CCGGGCAGTACATTGTGGCGGAATTCTCGAGAATTCCGCCACAATGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030698.4-1290s1c1
Sequence:CCGGGCCATCCCTCACATGGTTAAACTCGAGTTTAACCATGTGAGGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030698.4-954s1c1
Sequence:CCGGGCCAAGGGAGAAGCTGATATTCTCGAGAATATCAGCTTCTCCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030698.4-767s1c1
Sequence:CCGGCCAGGAGAAGCTACACTACTACTCGAGTAGTAGTGTAGCTTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030698.4-1391s1c1
Sequence:CCGGCTTGGAGTATAAGACAGATTTCTCGAGAAATCTGTCTTATACTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003449
TRIM26 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 26
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003449.x-522s1c1
Sequence:CCGGACACCGAGAGAAGCTGCACTACTCGAGTAGTGCAGCTTCTCTCGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003449.x-1119s1c1
Sequence:CCGGGCTGCTGAGAGACTTGGAATACTCGAGTATTCCAAGTCTCTCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003449.x-1423s1c1
Sequence:CCGGGATGGATATGACGACTGGGAACTCGAGTTCCCAGTCGTCATATCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003449.x-1122s1c1
Sequence:CCGGGCTGAGAGACTTGGAATATAACTCGAGTTATATTCCAAGTCTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003449.x-2484s1c1
Sequence:CCGGCTGGAGCTATCTGTGGTCTTACTCGAGTAAGACCACAGATAGCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003449.3-2434s21c1
Sequence:CCGGCAATTACGCCTAAGATCATTTCTCGAGAAATGATCTTAGGCGTAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003449.3-1213s21c1
Sequence:CCGGGACACGAGAGACTTCCTAAACCTCGAGGTTTAGGAAGTCTCTCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003449.3-897s21c1
Sequence:CCGGGAACCACCTGAGTACCCTAAGCTCGAGCTTAGGGTACTCAGGTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003449
TRIM26 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 26
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003449.x-522s1c1
Sequence:CCGGACACCGAGAGAAGCTGCACTACTCGAGTAGTGCAGCTTCTCTCGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003449.x-1119s1c1
Sequence:CCGGGCTGCTGAGAGACTTGGAATACTCGAGTATTCCAAGTCTCTCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003449.x-1423s1c1
Sequence:CCGGGATGGATATGACGACTGGGAACTCGAGTTCCCAGTCGTCATATCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003449.x-1122s1c1
Sequence:CCGGGCTGAGAGACTTGGAATATAACTCGAGTTATATTCCAAGTCTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003449.x-2484s1c1
Sequence:CCGGCTGGAGCTATCTGTGGTCTTACTCGAGTAAGACCACAGATAGCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003449.3-2434s21c1
Sequence:CCGGCAATTACGCCTAAGATCATTTCTCGAGAAATGATCTTAGGCGTAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003449.3-1213s21c1
Sequence:CCGGGACACGAGAGACTTCCTAAACCTCGAGGTTTAGGAAGTCTCTCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003449.3-897s21c1
Sequence:CCGGGAACCACCTGAGTACCCTAAGCTCGAGCTTAGGGTACTCAGGTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003449
TRIM26 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 26
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003449.x-522s1c1
Sequence:CCGGACACCGAGAGAAGCTGCACTACTCGAGTAGTGCAGCTTCTCTCGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003449.x-1119s1c1
Sequence:CCGGGCTGCTGAGAGACTTGGAATACTCGAGTATTCCAAGTCTCTCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003449.x-1423s1c1
Sequence:CCGGGATGGATATGACGACTGGGAACTCGAGTTCCCAGTCGTCATATCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003449.x-1122s1c1
Sequence:CCGGGCTGAGAGACTTGGAATATAACTCGAGTTATATTCCAAGTCTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003449.x-2484s1c1
Sequence:CCGGCTGGAGCTATCTGTGGTCTTACTCGAGTAAGACCACAGATAGCTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003449.3-2434s21c1
Sequence:CCGGCAATTACGCCTAAGATCATTTCTCGAGAAATGATCTTAGGCGTAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003449.3-1213s21c1
Sequence:CCGGGACACGAGAGACTTCCTAAACCTCGAGGTTTAGGAAGTCTCTCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003449.3-897s21c1
Sequence:CCGGGAACCACCTGAGTACCCTAAGCTCGAGCTTAGGGTACTCAGGTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025599
TRIM26 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 26
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025599.2-375s21c1
Sequence:CCGGTCGCAGCTGCACAAGTGATATCTCGAGATATCACTTGTGCAGCTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025599.2-825s21c1
Sequence:CCGGGTACATTGTGGCGGAATTTAACTCGAGTTAAATTCCGCCACAATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025599.2-1198s21c1
Sequence:CCGGCTGAGAGACTTGGAGTATAAGCTCGAGCTTATACTCCAAGTCTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025599.2-2137s21c1
Sequence:CCGGACTGTCACCCTATCCATATATCTCGAGATATATGGATAGGGTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025599.2-770s21c1
Sequence:CCGGCCAAGGGAGAAGCTGATATTCCTCGAGGAATATCAGCTTCTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025599
TRIM26 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 26
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025599.2-375s21c1
Sequence:CCGGTCGCAGCTGCACAAGTGATATCTCGAGATATCACTTGTGCAGCTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025599.2-825s21c1
Sequence:CCGGGTACATTGTGGCGGAATTTAACTCGAGTTAAATTCCGCCACAATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025599.2-1198s21c1
Sequence:CCGGCTGAGAGACTTGGAGTATAAGCTCGAGCTTATACTCCAAGTCTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025599.2-2137s21c1
Sequence:CCGGACTGTCACCCTATCCATATATCTCGAGATATATGGATAGGGTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025599.2-770s21c1
Sequence:CCGGCCAAGGGAGAAGCTGATATTCCTCGAGGAATATCAGCTTCTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025599
TRIM26 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 26
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025599.2-375s21c1
Sequence:CCGGTCGCAGCTGCACAAGTGATATCTCGAGATATCACTTGTGCAGCTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025599.2-825s21c1
Sequence:CCGGGTACATTGTGGCGGAATTTAACTCGAGTTAAATTCCGCCACAATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025599.2-1198s21c1
Sequence:CCGGCTGAGAGACTTGGAGTATAAGCTCGAGCTTATACTCCAAGTCTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025599.2-2137s21c1
Sequence:CCGGACTGTCACCCTATCCATATATCTCGAGATATATGGATAGGGTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025599.2-770s21c1
Sequence:CCGGCCAAGGGAGAAGCTGATATTCCTCGAGGAATATCAGCTTCTCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks