EMAIL THIS PAGE TO A FRIEND

TRIM27

tripartite motif containing 27

Synonyms: RFP RNF76
Gene ID:
Human(5987) Summary: This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to the nuclear matrix. It interacts with the enhancer of polycomb protein and represses gene transcription. It is also thought to be involved in the differentiation of male germ cells. Fusion of the N-terminus of this protein with the truncated C-terminus of the RET gene product has been shown to result in production of the ret transforming protein. [provided by RefSeq, Jul 2008]
Mouse(19720) tripartite motif-containing 27
Rat(291171) tripartite motif-containing 27
chicken(417042) tripartite motif containing 27
chicken(425772) tripartite motif containing 27
Horse(100060192) tripartite motif containing 27
domestic cat(101089610) tripartite motif containing 27
Domestic Rabbit(100340839) tripartite motif containing 27
naked mole-rat(101725144) tripartite motif containing 27
domestic guinea pig(100732725) tripartite motif containing 27
cow(520111) tripartite motif containing 27
sheep(101118230) tripartite motif containing 27
188 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006510 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006510 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006510 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009054 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009054 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009054 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006510 Rosetta Predictions human pricing
NM_030950 Rosetta Predictions human pricing
NM_001106115 Rosetta Predictions rat pricing
NM_001134974 Rosetta Predictions rat pricing
NM_009054 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341721 predicted 1228
2 SASI_Hs02_00341722 predicted 1772
3 SASI_Hs02_00341723 predicted 1460
4 SASI_Hs01_00163534 predicted 896
5 SASI_Hs01_00163535 predicted 766
6 SASI_Hs02_00341724 predicted 1502
7 SASI_Hs02_00341725 predicted 1344
8 SASI_Hs02_00341726 predicted 1277
9 SASI_Hs02_00341727 predicted 1565
10 SASI_Hs01_00163542 predicted 454
11 SASI_Hs01_00163536 predicted 2182
12 SASI_Hs01_00163537 predicted 2093
13 SASI_Hs01_00163538 predicted 2167
14 SASI_Hs01_00163539 predicted 2181
15 SASI_Hs01_00163540 predicted 2271
16 SASI_Hs01_00163541 predicted 2080
17 SASI_Hs01_00163543 predicted 2191
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130088 predicted 627
2 SASI_Hs01_00130089 predicted 579
3 SASI_Hs01_00130090 predicted 786
4 SASI_Hs01_00130091 predicted 1747
5 SASI_Hs01_00130092 predicted 1617
6 SASI_Hs01_00130093 predicted 900
7 SASI_Hs01_00130094 predicted 776
8 SASI_Hs01_00130095 predicted 1901
9 SASI_Hs01_00130096 predicted 1049
10 SASI_Hs01_00130097 predicted 1673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215768 predicted 1513
2 SASI_Rn02_00215769 predicted 1296
3 SASI_Rn02_00215770 predicted 1514
4 SASI_Rn02_00215771 predicted 581
5 SASI_Rn02_00215772 predicted 1505
6 SASI_Rn02_00215773 predicted 685
7 SASI_Rn02_00215774 predicted 372
8 SASI_Rn02_00215775 predicted 1299
9 SASI_Rn02_00215776 predicted 1482
10 SASI_Rn02_00215777 predicted 1472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134974 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259174 predicted 1713
2 SASI_Rn02_00259175 predicted 1848
3 SASI_Rn02_00259176 predicted 1649
4 SASI_Rn02_00259177 predicted 589
5 SASI_Rn02_00259178 predicted 700
6 SASI_Rn02_00259179 predicted 1507
7 SASI_Rn02_00259180 predicted 380
8 SASI_Rn02_00259181 predicted 1607
9 SASI_Rn02_00259182 predicted 1266
10 SASI_Rn02_00259183 predicted 1503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009054 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189099 predicted 944
2 SASI_Mm01_00189100 predicted 1585
3 SASI_Mm01_00189101 predicted 1886
4 SASI_Mm01_00189102 predicted 1512
5 SASI_Mm01_00189103 predicted 838
6 SASI_Mm01_00189104 predicted 1677
7 SASI_Mm01_00189106 predicted 1959
8 SASI_Mm01_00189107 predicted 625
9 SASI_Mm01_00189108 predicted 1525
10 SASI_Mm02_00315222 predicted 1447
11 SASI_Mm01_00189105 predicted 637
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006510
VALIDATED
TRIM27 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 27
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006510.4-2265s21c1
Sequence:GTACCGGCATAATGATTATGGCTATTTGCTCGAGCAAATAGCCATAATCATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006510.4-1127s21c1
Sequence:CCGGCAGGGCTGAAAGAATCAGGATCTCGAGATCCTGATTCTTTCAGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006510.4-897s21c1
Sequence:CCGGGAGAAGATTGTTTGGGAGTTTCTCGAGAAACTCCCAAACAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006510.4-2159s21c1
Sequence:CCGGCACATCGCTGGAGGGATAAAGCTCGAGCTTTATCCCTCCAGCGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006510.4-1278s21c1
Sequence:CCGGGAATTAAGAGAGGCTCAGTTACTCGAGTAACTGAGCCTCTCTTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_006510.4-1772s21c1
Sequence:CCGGGCCCTACTTCAGTCTGAGTTACTCGAGTAACTCAGACTGAAGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006436    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006510.3-2261s1c1
Sequence:CCGGCCACATAATGATTATGGCTATCTCGAGATAGCCATAATCATTATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006510.3-1277s1c1
Sequence:CCGGGAATTAAGAGAGGCTCAGTTACTCGAGTAACTGAGCCTCTCTTAATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006510.3-1126s1c1
Sequence:CCGGCAGGGCTGAAAGAATCAGGATCTCGAGATCCTGATTCTTTCAGCCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006510.3-896s1c1
Sequence:CCGGGAGAAGATTGTTTGGGAGTTTCTCGAGAAACTCCCAAACAATCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006510.3-1771s1c1
Sequence:CCGGGCCCTACTTCAGTCTGAGTTACTCGAGTAACTCAGACTGAAGTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006510
VALIDATED
TRIM27 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 27
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006510.4-2265s21c1
Sequence:GTACCGGCATAATGATTATGGCTATTTGCTCGAGCAAATAGCCATAATCATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006510.4-1127s21c1
Sequence:CCGGCAGGGCTGAAAGAATCAGGATCTCGAGATCCTGATTCTTTCAGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006510.4-897s21c1
Sequence:CCGGGAGAAGATTGTTTGGGAGTTTCTCGAGAAACTCCCAAACAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006510.4-2159s21c1
Sequence:CCGGCACATCGCTGGAGGGATAAAGCTCGAGCTTTATCCCTCCAGCGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006510.4-1278s21c1
Sequence:CCGGGAATTAAGAGAGGCTCAGTTACTCGAGTAACTGAGCCTCTCTTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_006510.4-1772s21c1
Sequence:CCGGGCCCTACTTCAGTCTGAGTTACTCGAGTAACTCAGACTGAAGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006436    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006510.3-2261s1c1
Sequence:CCGGCCACATAATGATTATGGCTATCTCGAGATAGCCATAATCATTATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006510.3-1277s1c1
Sequence:CCGGGAATTAAGAGAGGCTCAGTTACTCGAGTAACTGAGCCTCTCTTAATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006510.3-1126s1c1
Sequence:CCGGCAGGGCTGAAAGAATCAGGATCTCGAGATCCTGATTCTTTCAGCCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006510.3-896s1c1
Sequence:CCGGGAGAAGATTGTTTGGGAGTTTCTCGAGAAACTCCCAAACAATCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006510.3-1771s1c1
Sequence:CCGGGCCCTACTTCAGTCTGAGTTACTCGAGTAACTCAGACTGAAGTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006510
VALIDATED
TRIM27 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 27
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006510.4-2265s21c1
Sequence:GTACCGGCATAATGATTATGGCTATTTGCTCGAGCAAATAGCCATAATCATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006510.4-1127s21c1
Sequence:CCGGCAGGGCTGAAAGAATCAGGATCTCGAGATCCTGATTCTTTCAGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006510.4-897s21c1
Sequence:CCGGGAGAAGATTGTTTGGGAGTTTCTCGAGAAACTCCCAAACAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006510.4-2159s21c1
Sequence:CCGGCACATCGCTGGAGGGATAAAGCTCGAGCTTTATCCCTCCAGCGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006510.4-1278s21c1
Sequence:CCGGGAATTAAGAGAGGCTCAGTTACTCGAGTAACTGAGCCTCTCTTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_006510.4-1772s21c1
Sequence:CCGGGCCCTACTTCAGTCTGAGTTACTCGAGTAACTCAGACTGAAGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006436    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006510.3-2261s1c1
Sequence:CCGGCCACATAATGATTATGGCTATCTCGAGATAGCCATAATCATTATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006510.3-1277s1c1
Sequence:CCGGGAATTAAGAGAGGCTCAGTTACTCGAGTAACTGAGCCTCTCTTAATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006510.3-1126s1c1
Sequence:CCGGCAGGGCTGAAAGAATCAGGATCTCGAGATCCTGATTCTTTCAGCCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006510.3-896s1c1
Sequence:CCGGGAGAAGATTGTTTGGGAGTTTCTCGAGAAACTCCCAAACAATCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006510.3-1771s1c1
Sequence:CCGGGCCCTACTTCAGTCTGAGTTACTCGAGTAACTCAGACTGAAGTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009054
VALIDATED
TRIM27 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 27
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009054.2-980s21c1
Sequence:CCGGCCACCTAAGAAGAGTGAAAGACTCGAGTCTTTCACTCTTCTTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009054.2-1467s21c1
Sequence:CCGGGCTCAGTTATACTCAGTTGATCTCGAGATCAACTGAGTATAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009054.2-1097s21c1
Sequence:CCGGGCAGCTCTATCACTCGTTGAACTCGAGTTCAACGAGTGATAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009054.1-1106s1c1
Sequence:CCGGGCTCAGTTATACTCAGTTGATCTCGAGATCAACTGAGTATAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009054.1-1226s1c1
Sequence:CCGGCCTGAGCGATTCAATCTGTTTCTCGAGAAACAGATTGAATCGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009054.1-736s1c1
Sequence:CCGGGCAGCTCTATCACTCGTTGAACTCGAGTTCAACGAGTGATAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009054.1-619s1c1
Sequence:CCGGCCACCTAAGAAGAGTGAAAGACTCGAGTCTTTCACTCTTCTTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009054.1-1069s1c1
Sequence:CCGGGCAGTCAGATATGGAGAAGATCTCGAGATCTTCTCCATATCTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009054
VALIDATED
TRIM27 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 27
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009054.2-980s21c1
Sequence:CCGGCCACCTAAGAAGAGTGAAAGACTCGAGTCTTTCACTCTTCTTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009054.2-1467s21c1
Sequence:CCGGGCTCAGTTATACTCAGTTGATCTCGAGATCAACTGAGTATAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009054.2-1097s21c1
Sequence:CCGGGCAGCTCTATCACTCGTTGAACTCGAGTTCAACGAGTGATAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009054.1-1106s1c1
Sequence:CCGGGCTCAGTTATACTCAGTTGATCTCGAGATCAACTGAGTATAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009054.1-1226s1c1
Sequence:CCGGCCTGAGCGATTCAATCTGTTTCTCGAGAAACAGATTGAATCGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009054.1-736s1c1
Sequence:CCGGGCAGCTCTATCACTCGTTGAACTCGAGTTCAACGAGTGATAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009054.1-619s1c1
Sequence:CCGGCCACCTAAGAAGAGTGAAAGACTCGAGTCTTTCACTCTTCTTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009054.1-1069s1c1
Sequence:CCGGGCAGTCAGATATGGAGAAGATCTCGAGATCTTCTCCATATCTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009054
VALIDATED
TRIM27 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 27
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009054.2-980s21c1
Sequence:CCGGCCACCTAAGAAGAGTGAAAGACTCGAGTCTTTCACTCTTCTTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009054.2-1467s21c1
Sequence:CCGGGCTCAGTTATACTCAGTTGATCTCGAGATCAACTGAGTATAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009054.2-1097s21c1
Sequence:CCGGGCAGCTCTATCACTCGTTGAACTCGAGTTCAACGAGTGATAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009054.1-1106s1c1
Sequence:CCGGGCTCAGTTATACTCAGTTGATCTCGAGATCAACTGAGTATAACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009054.1-1226s1c1
Sequence:CCGGCCTGAGCGATTCAATCTGTTTCTCGAGAAACAGATTGAATCGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009054.1-736s1c1
Sequence:CCGGGCAGCTCTATCACTCGTTGAACTCGAGTTCAACGAGTGATAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009054.1-619s1c1
Sequence:CCGGCCACCTAAGAAGAGTGAAAGACTCGAGTCTTTCACTCTTCTTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009054.1-1069s1c1
Sequence:CCGGGCAGTCAGATATGGAGAAGATCTCGAGATCTTCTCCATATCTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks