EMAIL THIS PAGE TO A FRIEND

TRIM28

tripartite motif containing 28

Synonyms: KAP1 RNF96 TF1B TIF1B
UniProtKB ID: Q13263, O00677, Q7Z632, Q93040, Q96IM1
Gene ID:
Human(10155) Summary: The protein encoded by this gene mediates transcriptional control by interaction with the Kruppel-associated box repression domain found in many transcription factors. The protein localizes to the nucleus and is thought to associate with specific chromatin regions. The protein is a member of the tripartite motif family. This tripartite motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. [provided by RefSeq, Jul 2008]
Mouse(21849) tripartite motif-containing 28
Rat(116698) tripartite motif-containing 28
chicken(430538) tripartite motif containing 28
domestic cat(101086190) tripartite motif containing 28
dog(403689) tripartite motif containing 28
cow(519422) tripartite motif containing 28
sheep(101121196) tripartite motif containing 28
domestic guinea pig(100717540) tripartite motif containing 28
naked mole-rat(101723214) tripartite motif containing 28
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500551 Anti-KAP1/TRIM28 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4300694 Anti-TIF1β antibody produced in rabbit affinity isolated antibody human, monkey
western blot pricing
SAB2102546 Anti-TRIM28 (ab1) antibody produced in rabbit affinity isolated antibody bovine, mouse, rat, human
western blot pricing
SAB2102547 Anti-TRIM28 (ab2) antibody produced in rabbit affinity isolated antibody horse, rat, mouse, guinea pig, bovine, human, canine, zebrafish, rabbit
western blot pricing
SAB1406938 Anti-TRIM28 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV38681 Anti-TRIM28 antibody produced in rabbit IgG fraction of antiserum rabbit, bovine, rat, horse, mouse, guinea pig, human, canine
western blot pricing
HPA064033 Anti-TRIM28 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2701980 Anti-TRIM28 antibody produced in rabbit mouse, human
ChIP, immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing
PLA0295 Goat anti-KAP-1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human
immunoprecipitation, proximity ligation assay, western blot pricing
WH0010155M1 Monoclonal Anti-TRIM28 antibody produced in mouse clone 4E6, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404789 Monoclonal Anti-TRIM28 antibody produced in mouse clone 1D11, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
PLA0078 Rabbit anti-KAP-1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, human
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing
PLA0140 Rabbit anti-Phospho KAP-1 (S824) Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, primate, marmoset, gorilla, gibbon, rhesus monkey, chimpanzee, human
immunofluorescence, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005762 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005762 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005762 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011588 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011588 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011588 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005762 siRNAs that have been validated in the lab human pricing
XM_001062234 Rosetta Predictions rat pricing
XM_344861 Rosetta Predictions rat pricing
NM_011588 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005762 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205060 validated 2397
2 SASI_Hs01_00205058 predicted 857
3 SASI_Hs01_00205059 predicted 2196
4 SASI_Hs01_00205061 predicted 848
5 SASI_Hs01_00205062 predicted 1997
6 SASI_Hs01_00205063 predicted 1628
7 SASI_Hs01_00205064 predicted 903
8 SASI_Hs01_00205065 predicted 879
9 SASI_Hs01_00205066 predicted 1679
10 SASI_Hs01_00205067 predicted 1028
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062234 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302758 predicted 998
2 SASI_Rn02_00302759 predicted 1738
3 SASI_Rn02_00302760 predicted 1929
4 SASI_Rn02_00302761 predicted 1552
5 SASI_Rn02_00302762 predicted 725
6 SASI_Rn02_00302763 predicted 1469
7 SASI_Rn02_00302764 predicted 1120
8 SASI_Rn02_00302765 predicted 1107
9 SASI_Rn02_00302766 predicted 1271
10 SASI_Rn02_00302767 predicted 2684
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344861 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397676 predicted 1182
2 SASI_Rn02_00397677 predicted 1920
3 SASI_Rn02_00397678 predicted 2113
4 SASI_Rn02_00397679 predicted 1742
5 SASI_Rn02_00397680 predicted 914
6 SASI_Rn02_00397681 predicted 1658
7 SASI_Rn02_00397682 predicted 1312
8 SASI_Rn02_00397683 predicted 1299
9 SASI_Rn02_00397684 predicted 1465
10 SASI_Rn02_00397685 predicted 2865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011588 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036667 predicted 1182
2 SASI_Mm01_00036669 predicted 1987
3 SASI_Mm01_00036670 predicted 914
4 SASI_Mm01_00036671 predicted 2108
5 SASI_Mm01_00036672 predicted 1461
6 SASI_Mm02_00320984 predicted 1996
7 SASI_Mm01_00036673 predicted 2845
8 SASI_Mm01_00036674 predicted 1909
9 SASI_Mm01_00036675 predicted 1275
10 SASI_Mm01_00036676 predicted 1727
11 SASI_Mm01_00036668 predicted 2923
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005762
VALIDATED
TRIM28 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 28
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005762.2-2824s1c1
Sequence:CCGGCCTGGCTCTGTTCTCTGTCCTCTCGAGAGGACAGAGAACAGAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005762.2-1832s1c1
Sequence:CCGGGAGGACTACAACCTTATTGTTCTCGAGAACAATAAGGTTGTAGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005762.2-2004s1c1
Sequence:CCGGCTGAGACCAAACCTGTGCTTACTCGAGTAAGCACAGGTTTGGTCTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005762.2-680s1c1
Sequence:CCGGGAGAATTATTTCATGCGTGATCTCGAGATCACGCATGAAATAATTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005762.2-1004s1c1
Sequence:CCGGGACCACCAGTACCAGTTCTTACTCGAGTAAGAACTGGTACTGGTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199141    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005762.2-2829s1c1
Sequence:CCGGCTCTGTTCTCTGTCCTGTCACCTCGAGGTGACAGGACAGAGAACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005762.2-670s21c1
Sequence:CCGGAGACATCGTGGAGAATTATTTCTCGAGAAATAATTCTCCACGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005762.2-747s21c1
Sequence:CCGGGCACTAGCTGTGAGGATAATGCTCGAGCATTATCCTCACAGCTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005762.2-894s21c1
Sequence:CCGGATGGTGAACGTACTGTCTATTCTCGAGAATAGACAGTACGTTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005762.2-1829s21c1
Sequence:CCGGACTGAGGACTACAACCTTATTCTCGAGAATAAGGTTGTAGTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005762
VALIDATED
TRIM28 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 28
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005762.2-2824s1c1
Sequence:CCGGCCTGGCTCTGTTCTCTGTCCTCTCGAGAGGACAGAGAACAGAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005762.2-1832s1c1
Sequence:CCGGGAGGACTACAACCTTATTGTTCTCGAGAACAATAAGGTTGTAGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005762.2-2004s1c1
Sequence:CCGGCTGAGACCAAACCTGTGCTTACTCGAGTAAGCACAGGTTTGGTCTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005762.2-680s1c1
Sequence:CCGGGAGAATTATTTCATGCGTGATCTCGAGATCACGCATGAAATAATTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005762.2-1004s1c1
Sequence:CCGGGACCACCAGTACCAGTTCTTACTCGAGTAAGAACTGGTACTGGTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199141    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005762.2-2829s1c1
Sequence:CCGGCTCTGTTCTCTGTCCTGTCACCTCGAGGTGACAGGACAGAGAACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005762.2-670s21c1
Sequence:CCGGAGACATCGTGGAGAATTATTTCTCGAGAAATAATTCTCCACGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005762.2-747s21c1
Sequence:CCGGGCACTAGCTGTGAGGATAATGCTCGAGCATTATCCTCACAGCTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005762.2-894s21c1
Sequence:CCGGATGGTGAACGTACTGTCTATTCTCGAGAATAGACAGTACGTTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005762.2-1829s21c1
Sequence:CCGGACTGAGGACTACAACCTTATTCTCGAGAATAAGGTTGTAGTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005762
VALIDATED
TRIM28 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 28
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005762.2-2824s1c1
Sequence:CCGGCCTGGCTCTGTTCTCTGTCCTCTCGAGAGGACAGAGAACAGAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005762.2-1832s1c1
Sequence:CCGGGAGGACTACAACCTTATTGTTCTCGAGAACAATAAGGTTGTAGTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005762.2-2004s1c1
Sequence:CCGGCTGAGACCAAACCTGTGCTTACTCGAGTAAGCACAGGTTTGGTCTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005762.2-680s1c1
Sequence:CCGGGAGAATTATTTCATGCGTGATCTCGAGATCACGCATGAAATAATTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005762.2-1004s1c1
Sequence:CCGGGACCACCAGTACCAGTTCTTACTCGAGTAAGAACTGGTACTGGTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199141    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005762.2-2829s1c1
Sequence:CCGGCTCTGTTCTCTGTCCTGTCACCTCGAGGTGACAGGACAGAGAACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005762.2-670s21c1
Sequence:CCGGAGACATCGTGGAGAATTATTTCTCGAGAAATAATTCTCCACGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005762.2-747s21c1
Sequence:CCGGGCACTAGCTGTGAGGATAATGCTCGAGCATTATCCTCACAGCTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005762.2-894s21c1
Sequence:CCGGATGGTGAACGTACTGTCTATTCTCGAGAATAGACAGTACGTTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005762.2-1829s21c1
Sequence:CCGGACTGAGGACTACAACCTTATTCTCGAGAATAAGGTTGTAGTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011588
VALIDATED
TRIM28 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 28
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011588.1-2856s1c1
Sequence:CCGGCCGCATGTTCAAACAGTTCAACTCGAGTTGAACTGTTTGAACATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011588.1-2470s1c1
Sequence:CCGGGTCATGTGTAACCAGTGCGAACTCGAGTTCGCACTGGTTACACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011588.1-1647s1c1
Sequence:CCGGGCTCTCTAAGAAGCTGATCTACTCGAGTAGATCAGCTTCTTAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011588.1-2065s1c1
Sequence:CCGGCCACCAGTCTTCAAGGTCTTTCTCGAGAAAGACCTTGAAGACTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011588.3-2632s21c1
Sequence:CCGGAGCACTGGTGTGGTAGCTAAACTCGAGTTTAGCTACCACACCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011588.3-1312s21c1
Sequence:CCGGGCAGTGAGGAACCAACGTAAACTCGAGTTTACGTTGGTTCCTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011588.3-2112s21c1
Sequence:CCGGGGACTACAATCTGATTGTTATCTCGAGATAACAATCAGATTGTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011588.3-951s21c1
Sequence:CCGGAGACATCGTGGAGAATTATTTCTCGAGAAATAATTCTCCACGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011588.3-1922s21c1
Sequence:CCGGTTGGGTCAGATGATCCCTATTCTCGAGAATAGGGATCATCTGACCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011588
VALIDATED
TRIM28 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 28
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011588.1-2856s1c1
Sequence:CCGGCCGCATGTTCAAACAGTTCAACTCGAGTTGAACTGTTTGAACATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011588.1-2470s1c1
Sequence:CCGGGTCATGTGTAACCAGTGCGAACTCGAGTTCGCACTGGTTACACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011588.1-1647s1c1
Sequence:CCGGGCTCTCTAAGAAGCTGATCTACTCGAGTAGATCAGCTTCTTAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011588.1-2065s1c1
Sequence:CCGGCCACCAGTCTTCAAGGTCTTTCTCGAGAAAGACCTTGAAGACTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011588.3-2632s21c1
Sequence:CCGGAGCACTGGTGTGGTAGCTAAACTCGAGTTTAGCTACCACACCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011588.3-1312s21c1
Sequence:CCGGGCAGTGAGGAACCAACGTAAACTCGAGTTTACGTTGGTTCCTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011588.3-2112s21c1
Sequence:CCGGGGACTACAATCTGATTGTTATCTCGAGATAACAATCAGATTGTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011588.3-951s21c1
Sequence:CCGGAGACATCGTGGAGAATTATTTCTCGAGAAATAATTCTCCACGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011588.3-1922s21c1
Sequence:CCGGTTGGGTCAGATGATCCCTATTCTCGAGAATAGGGATCATCTGACCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011588
VALIDATED
TRIM28 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 28
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011588.1-2856s1c1
Sequence:CCGGCCGCATGTTCAAACAGTTCAACTCGAGTTGAACTGTTTGAACATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011588.1-2470s1c1
Sequence:CCGGGTCATGTGTAACCAGTGCGAACTCGAGTTCGCACTGGTTACACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011588.1-1647s1c1
Sequence:CCGGGCTCTCTAAGAAGCTGATCTACTCGAGTAGATCAGCTTCTTAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011588.1-2065s1c1
Sequence:CCGGCCACCAGTCTTCAAGGTCTTTCTCGAGAAAGACCTTGAAGACTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011588.3-2632s21c1
Sequence:CCGGAGCACTGGTGTGGTAGCTAAACTCGAGTTTAGCTACCACACCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011588.3-1312s21c1
Sequence:CCGGGCAGTGAGGAACCAACGTAAACTCGAGTTTACGTTGGTTCCTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011588.3-2112s21c1
Sequence:CCGGGGACTACAATCTGATTGTTATCTCGAGATAACAATCAGATTGTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011588.3-951s21c1
Sequence:CCGGAGACATCGTGGAGAATTATTTCTCGAGAAATAATTCTCCACGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011588.3-1922s21c1
Sequence:CCGGTTGGGTCAGATGATCCCTATTCTCGAGAATAGGGATCATCTGACCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks