EMAIL THIS PAGE TO A FRIEND

TRIM29

tripartite motif containing 29

Synonyms: ATDC
UniProtKB ID: Q14134, Q96AA9, Q9BZY7
Gene ID:
Human(23650) Summary: The protein encoded by this gene belongs to the TRIM protein family. It has multiple zinc finger motifs and a leucine zipper motif. It has been proposed to form homo- or heterodimers which are involved in nucleic acid binding. Thus, it may act as a transcriptional regulatory factor involved in carcinogenesis and/or differentiation. It may also function in the suppression of radiosensitivity since it is associated with ataxia telangiectasia phenotype. [provided by RefSeq, Jul 2008]
Mouse(72169) tripartite motif-containing 29
Rat(300656) tripartite motif-containing 29
naked mole-rat(101714564) tripartite motif containing 29
domestic guinea pig(100716654) tripartite motif containing 29
cow(525062) tripartite motif containing 29
sheep(101116425) tripartite motif containing 29
chicken(419754) tripartite motif-containing 29
dog(489362) tripartite motif containing 29
Horse(100071461) tripartite motif containing 29
domestic cat(101098485) tripartite motif containing 29
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012101 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012101 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012101 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023655 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023655 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023655 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU087831 MISSION® esiRNA esiRNA human TRIM29 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012101 Rosetta Predictions human pricing
NM_058193 Rosetta Predictions human pricing
NM_001106815 Rosetta Predictions rat pricing
NM_023655 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059260 predicted 1234
2 SASI_Hs02_00343612 predicted 1953
3 SASI_Hs02_00343613 predicted 1810
4 SASI_Hs02_00343614 predicted 1236
5 SASI_Hs02_00343615 predicted 378
6 SASI_Hs02_00343616 predicted 350
7 SASI_Hs02_00343617 predicted 1628
8 SASI_Hs02_00343618 predicted 389
9 SASI_Hs02_00343619 predicted 1418
10 SASI_Hs02_00343620 predicted 1696
11 SASI_Hs01_00059256 predicted 1013
12 SASI_Hs01_00059257 predicted 1410
13 SASI_Hs01_00059258 predicted 1311
14 SASI_Hs01_00059259 predicted 924
15 SASI_Hs01_00059261 predicted 811
16 SASI_Hs01_00059262 predicted 464
17 SASI_Hs01_00059263 predicted 780
18 SASI_Hs01_00059264 predicted 1520
19 SASI_Hs01_00059265 predicted 1342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058193 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212883 predicted 1014
2 SASI_Hs01_00212884 predicted 1417
3 SASI_Hs01_00212885 predicted 1311
4 SASI_Hs01_00212886 predicted 919
5 SASI_Hs01_00212887 predicted 1240
6 SASI_Hs01_00212888 predicted 809
7 SASI_Hs01_00212889 predicted 473
8 SASI_Hs01_00212890 predicted 778
9 SASI_Hs01_00212891 predicted 1529
10 SASI_Hs01_00212892 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106815 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222678 predicted 767
2 SASI_Rn02_00222679 predicted 1511
3 SASI_Rn02_00222680 predicted 1404
4 SASI_Rn02_00222681 predicted 1530
5 SASI_Rn02_00222682 predicted 205
6 SASI_Rn02_00222683 predicted 460
7 SASI_Rn02_00222684 predicted 1613
8 SASI_Rn02_00222685 predicted 1251
9 SASI_Rn02_00222686 predicted 1496
10 SASI_Rn02_00222687 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023655 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162915 predicted 1251
2 SASI_Mm01_00162916 predicted 1397
3 SASI_Mm02_00327271 predicted 802
4 SASI_Mm01_00162921 predicted 1242
5 SASI_Mm02_00327272 predicted 203
6 SASI_Mm02_00327273 predicted 450
7 SASI_Mm02_00327274 predicted 384
8 SASI_Mm02_00327275 predicted 761
9 SASI_Mm01_00162922 predicted 1809
10 SASI_Mm02_00327276 predicted 324
11 SASI_Mm01_00162917 predicted 492
12 SASI_Mm01_00162918 predicted 1441
13 SASI_Mm01_00162919 predicted 634
14 SASI_Mm01_00162920 predicted 908
15 SASI_Mm01_00162923 predicted 1112
16 SASI_Mm01_00162924 predicted 1342
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012101
TRIM29 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 29
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012101.3-2222s21c1
Sequence:CCGGAGTGAGTACCCGCATGGTATCCTCGAGGATACCATGCGGGTACTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012101.3-1233s21c1
Sequence:CCGGTCAGCGACTCTGTGTTGTTTCCTCGAGGAAACAACACAGAGTCGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012101.3-1416s21c1
Sequence:CCGGACCTGAGCCGTAACTTCATTGCTCGAGCAATGAAGTTACGGCTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012101.3-1623s21c1
Sequence:CCGGAGAATTTCAACAATCTCTATGCTCGAGCATAGAGATTGTTGAAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012101.2-1838s1c1
Sequence:CCGGCGGCCATTCTACGTCAACAAACTCGAGTTTGTTGACGTAGAATGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012101.2-1390s1c1
Sequence:CCGGCCACGTTGAGAAGATGTGCAACTCGAGTTGCACATCTTCTCAACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012101.2-1465s1c1
Sequence:CCGGCCATCGCTATGTGAACAACTACTCGAGTAGTTGTTCACATAGCGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012101.2-1255s1c1
Sequence:CCGGGCAGGAATTTGGTGCATTGATCTCGAGATCAATGCACCAAATTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012101.2-385s1c1
Sequence:CCGGCGACAAGAACTCCAACTACTTCTCGAGAAGTAGTTGGAGTTCTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012101
TRIM29 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 29
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012101.3-2222s21c1
Sequence:CCGGAGTGAGTACCCGCATGGTATCCTCGAGGATACCATGCGGGTACTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012101.3-1233s21c1
Sequence:CCGGTCAGCGACTCTGTGTTGTTTCCTCGAGGAAACAACACAGAGTCGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012101.3-1416s21c1
Sequence:CCGGACCTGAGCCGTAACTTCATTGCTCGAGCAATGAAGTTACGGCTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012101.3-1623s21c1
Sequence:CCGGAGAATTTCAACAATCTCTATGCTCGAGCATAGAGATTGTTGAAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012101.2-1838s1c1
Sequence:CCGGCGGCCATTCTACGTCAACAAACTCGAGTTTGTTGACGTAGAATGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012101.2-1390s1c1
Sequence:CCGGCCACGTTGAGAAGATGTGCAACTCGAGTTGCACATCTTCTCAACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012101.2-1465s1c1
Sequence:CCGGCCATCGCTATGTGAACAACTACTCGAGTAGTTGTTCACATAGCGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012101.2-1255s1c1
Sequence:CCGGGCAGGAATTTGGTGCATTGATCTCGAGATCAATGCACCAAATTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012101.2-385s1c1
Sequence:CCGGCGACAAGAACTCCAACTACTTCTCGAGAAGTAGTTGGAGTTCTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012101
TRIM29 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 29
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012101.3-2222s21c1
Sequence:CCGGAGTGAGTACCCGCATGGTATCCTCGAGGATACCATGCGGGTACTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012101.3-1233s21c1
Sequence:CCGGTCAGCGACTCTGTGTTGTTTCCTCGAGGAAACAACACAGAGTCGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012101.3-1416s21c1
Sequence:CCGGACCTGAGCCGTAACTTCATTGCTCGAGCAATGAAGTTACGGCTCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012101.3-1623s21c1
Sequence:CCGGAGAATTTCAACAATCTCTATGCTCGAGCATAGAGATTGTTGAAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012101.2-1838s1c1
Sequence:CCGGCGGCCATTCTACGTCAACAAACTCGAGTTTGTTGACGTAGAATGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012101.2-1390s1c1
Sequence:CCGGCCACGTTGAGAAGATGTGCAACTCGAGTTGCACATCTTCTCAACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012101.2-1465s1c1
Sequence:CCGGCCATCGCTATGTGAACAACTACTCGAGTAGTTGTTCACATAGCGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012101.2-1255s1c1
Sequence:CCGGGCAGGAATTTGGTGCATTGATCTCGAGATCAATGCACCAAATTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012101.2-385s1c1
Sequence:CCGGCGACAAGAACTCCAACTACTTCTCGAGAAGTAGTTGGAGTTCTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023655
TRIM29 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 29
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023655.2-196s21c1
Sequence:CCGGGCCTAGAGAATGGCACTAAAGCTCGAGCTTTAGTGCCATTCTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023655.2-1388s21c1
Sequence:CCGGGAAGATGTGCAAGGCCGATTTCTCGAGAAATCGGCCTTGCACATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217235    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023655.2-2531s1c1
Sequence:CCGGCTATAGACGTTCACTACTATGCTCGAGCATAGTAGTGAACGTCTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023655.2-361s21c1
Sequence:CCGGTGGAGTCTGTCGACGACAAAGCTCGAGCTTTGTCGTCGACAGACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023655.2-1253s21c1
Sequence:CCGGTGGTGCATTGATGAGCAATTACTCGAGTAATTGCTCATCAATGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023655.2-2448s21c1
Sequence:CCGGAGGATTGTAGCCTAGACATTTCTCGAGAAATGTCTAGGCTACAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023655.1-205s1c1
Sequence:CCGGGATGATGTTGAGAAGTGGCAACTCGAGTTGCCACTTCTCAACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023655.1-180s1c1
Sequence:CCGGGCAACTGAAGATCATTGAGATCTCGAGATCTCAATGATCTTCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023655
TRIM29 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 29
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023655.2-196s21c1
Sequence:CCGGGCCTAGAGAATGGCACTAAAGCTCGAGCTTTAGTGCCATTCTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023655.2-1388s21c1
Sequence:CCGGGAAGATGTGCAAGGCCGATTTCTCGAGAAATCGGCCTTGCACATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217235    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023655.2-2531s1c1
Sequence:CCGGCTATAGACGTTCACTACTATGCTCGAGCATAGTAGTGAACGTCTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023655.2-361s21c1
Sequence:CCGGTGGAGTCTGTCGACGACAAAGCTCGAGCTTTGTCGTCGACAGACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023655.2-1253s21c1
Sequence:CCGGTGGTGCATTGATGAGCAATTACTCGAGTAATTGCTCATCAATGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023655.2-2448s21c1
Sequence:CCGGAGGATTGTAGCCTAGACATTTCTCGAGAAATGTCTAGGCTACAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023655.1-205s1c1
Sequence:CCGGGATGATGTTGAGAAGTGGCAACTCGAGTTGCCACTTCTCAACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023655.1-180s1c1
Sequence:CCGGGCAACTGAAGATCATTGAGATCTCGAGATCTCAATGATCTTCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023655
TRIM29 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 29
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023655.2-196s21c1
Sequence:CCGGGCCTAGAGAATGGCACTAAAGCTCGAGCTTTAGTGCCATTCTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023655.2-1388s21c1
Sequence:CCGGGAAGATGTGCAAGGCCGATTTCTCGAGAAATCGGCCTTGCACATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217235    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023655.2-2531s1c1
Sequence:CCGGCTATAGACGTTCACTACTATGCTCGAGCATAGTAGTGAACGTCTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023655.2-361s21c1
Sequence:CCGGTGGAGTCTGTCGACGACAAAGCTCGAGCTTTGTCGTCGACAGACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023655.2-1253s21c1
Sequence:CCGGTGGTGCATTGATGAGCAATTACTCGAGTAATTGCTCATCAATGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023655.2-2448s21c1
Sequence:CCGGAGGATTGTAGCCTAGACATTTCTCGAGAAATGTCTAGGCTACAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023655.1-205s1c1
Sequence:CCGGGATGATGTTGAGAAGTGGCAACTCGAGTTGCCACTTCTCAACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023655.1-180s1c1
Sequence:CCGGGCAACTGAAGATCATTGAGATCTCGAGATCTCAATGATCTTCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks