EMAIL THIS PAGE TO A FRIEND

TRIM2

tripartite motif containing 2

Synonyms: RNF86
UniProtKB ID: Q9C040, D3DP09, O60272, Q9BSI9, Q9UFZ1
Gene ID:
Human(23321) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic filaments. Its function has not been identified. [provided by RefSeq, Jul 2008]
Mouse(80890) tripartite motif-containing 2
Rat(361970) tripartite motif-containing 2
naked mole-rat(101722774) tripartite motif containing 2
Domestic Rabbit(100352090) tripartite motif containing 2
domestic guinea pig(100718148) tripartite motif containing 2
cow(538617) tripartite motif containing 2
sheep(101103349) tripartite motif containing 2
chicken(100857562) tripartite motif containing 2
domestic cat(101094591) tripartite motif containing 2
Horse(100062188) tripartite motif containing 2
dog(475470) tripartite motif containing 2
264 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030706 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030706 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030706 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015271 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015271 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015271 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015271 Rosetta Predictions human pricing
NM_001108552 Rosetta Predictions rat pricing
NM_030706 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237639 predicted 1775
2 SASI_Hs01_00237640 predicted 2074
3 SASI_Hs01_00237641 predicted 1906
4 SASI_Hs01_00237642 predicted 2094
5 SASI_Hs01_00237644 predicted 292
6 SASI_Hs01_00237646 predicted 1061
7 SASI_Hs02_00347428 predicted 1973
8 SASI_Hs01_00237647 predicted 2143
9 SASI_Hs02_00347429 predicted 1152
10 SASI_Hs01_00237648 predicted 1665
11 SASI_Hs01_00237643 predicted 2347
12 SASI_Hs01_00237645 predicted 2213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108552 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239769 predicted 1910
2 SASI_Rn02_00239770 predicted 427
3 SASI_Rn02_00239771 predicted 1960
4 SASI_Rn02_00239772 predicted 2489
5 SASI_Rn02_00239773 predicted 1813
6 SASI_Rn02_00239774 predicted 642
7 SASI_Rn02_00239775 predicted 1627
8 SASI_Rn02_00239776 predicted 1186
9 SASI_Rn02_00239777 predicted 2477
10 SASI_Rn02_00239778 predicted 2171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030706 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199567 predicted 1952
2 SASI_Mm01_00199568 predicted 1538
3 SASI_Mm01_00199569 predicted 1973
4 SASI_Mm01_00199570 predicted 2252
5 SASI_Mm01_00199571 predicted 2587
6 SASI_Mm01_00199572 predicted 1775
7 SASI_Mm01_00199573 predicted 2187
8 SASI_Mm01_00199574 predicted 2324
9 SASI_Mm01_00199575 predicted 1835
10 SASI_Mm02_00336883 predicted 2294
11 SASI_Mm01_00199576 predicted 2443
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030706
VALIDATED
TRIM2 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030706.1-3074s1c1
Sequence:CCGGCCCATCAGAATCAATGCAAATCTCGAGATTTGCATTGATTCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030706.1-825s1c1
Sequence:CCGGGCTCTTCAGTTCATCTCAGAACTCGAGTTCTGAGATGAACTGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030706.1-2309s1c1
Sequence:CCGGCGTGGACTCAAATGGGAACATCTCGAGATGTTCCCATTTGAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030706.1-2042s1c1
Sequence:CCGGGCACATTATTGTGGTGGACAACTCGAGTTGTCCACCACAATAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030706.1-321s1c1
Sequence:CCGGCGCCAGATTGACAAGCAGTTTCTCGAGAAACTGCTTGTCAATCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030706.2-3090s21c1
Sequence:CCGGCCCATCAGAATCAATGCAAATCTCGAGATTTGCATTGATTCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030706.2-337s21c1
Sequence:CCGGCGCCAGATTGACAAGCAGTTTCTCGAGAAACTGCTTGTCAATCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030706.2-2325s21c1
Sequence:CCGGCGTGGACTCAAATGGGAACATCTCGAGATGTTCCCATTTGAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030706.2-841s21c1
Sequence:CCGGGCTCTTCAGTTCATCTCAGAACTCGAGTTCTGAGATGAACTGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030706.2-2058s21c1
Sequence:CCGGGCACATTATTGTGGTGGACAACTCGAGTTGTCCACCACAATAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030706
VALIDATED
TRIM2 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030706.1-3074s1c1
Sequence:CCGGCCCATCAGAATCAATGCAAATCTCGAGATTTGCATTGATTCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030706.1-825s1c1
Sequence:CCGGGCTCTTCAGTTCATCTCAGAACTCGAGTTCTGAGATGAACTGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030706.1-2309s1c1
Sequence:CCGGCGTGGACTCAAATGGGAACATCTCGAGATGTTCCCATTTGAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030706.1-2042s1c1
Sequence:CCGGGCACATTATTGTGGTGGACAACTCGAGTTGTCCACCACAATAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030706.1-321s1c1
Sequence:CCGGCGCCAGATTGACAAGCAGTTTCTCGAGAAACTGCTTGTCAATCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030706.2-3090s21c1
Sequence:CCGGCCCATCAGAATCAATGCAAATCTCGAGATTTGCATTGATTCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030706.2-337s21c1
Sequence:CCGGCGCCAGATTGACAAGCAGTTTCTCGAGAAACTGCTTGTCAATCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030706.2-2325s21c1
Sequence:CCGGCGTGGACTCAAATGGGAACATCTCGAGATGTTCCCATTTGAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030706.2-841s21c1
Sequence:CCGGGCTCTTCAGTTCATCTCAGAACTCGAGTTCTGAGATGAACTGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030706.2-2058s21c1
Sequence:CCGGGCACATTATTGTGGTGGACAACTCGAGTTGTCCACCACAATAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030706
VALIDATED
TRIM2 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030706.1-3074s1c1
Sequence:CCGGCCCATCAGAATCAATGCAAATCTCGAGATTTGCATTGATTCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030706.1-825s1c1
Sequence:CCGGGCTCTTCAGTTCATCTCAGAACTCGAGTTCTGAGATGAACTGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030706.1-2309s1c1
Sequence:CCGGCGTGGACTCAAATGGGAACATCTCGAGATGTTCCCATTTGAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030706.1-2042s1c1
Sequence:CCGGGCACATTATTGTGGTGGACAACTCGAGTTGTCCACCACAATAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030706.1-321s1c1
Sequence:CCGGCGCCAGATTGACAAGCAGTTTCTCGAGAAACTGCTTGTCAATCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030706.2-3090s21c1
Sequence:CCGGCCCATCAGAATCAATGCAAATCTCGAGATTTGCATTGATTCTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030706.2-337s21c1
Sequence:CCGGCGCCAGATTGACAAGCAGTTTCTCGAGAAACTGCTTGTCAATCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030706.2-2325s21c1
Sequence:CCGGCGTGGACTCAAATGGGAACATCTCGAGATGTTCCCATTTGAGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030706.2-841s21c1
Sequence:CCGGGCTCTTCAGTTCATCTCAGAACTCGAGTTCTGAGATGAACTGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030706.2-2058s21c1
Sequence:CCGGGCACATTATTGTGGTGGACAACTCGAGTTGTCCACCACAATAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015271
VALIDATED
TRIM2 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015271.2-4029s1c1
Sequence:CCGGGCACCTTAGAACTGTACTATACTCGAGTATAGTACAGTTCTAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015271.2-1907s1c1
Sequence:CCGGGCACATTATTGTTGTGGACAACTCGAGTTGTCCACAACAATAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015271.2-371s1c1
Sequence:CCGGCGCGCTCCAGAACAATTTCTTCTCGAGAAGAAATTGTTCTGGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015271.2-1482s1c1
Sequence:CCGGGTCAAGCAGAAAGCTGTGAAACTCGAGTTTCACAGCTTTCTGCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015271.2-742s1c1
Sequence:CCGGGCATCGTGGATGACATTCATTCTCGAGAATGAATGTCATCCACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015271.3-1104s21c1
Sequence:CCGGACAACCTCGGGACGATCTTAACTCGAGTTAAGATCGTCCCGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015271.3-2425s21c1
Sequence:CCGGTCCATGGTCTTGCACTATAAACTCGAGTTTATAGTGCAAGACCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015271.3-1502s21c1
Sequence:CCGGGTCAAGCAGAAAGCTGTGAAACTCGAGTTTCACAGCTTTCTGCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015271.3-391s21c1
Sequence:CCGGCGCGCTCCAGAACAATTTCTTCTCGAGAAGAAATTGTTCTGGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015271.3-2252s21c1
Sequence:CCGGTTTGATGGGAGTGGATCATTTCTCGAGAAATGATCCACTCCCATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015271
VALIDATED
TRIM2 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015271.2-4029s1c1
Sequence:CCGGGCACCTTAGAACTGTACTATACTCGAGTATAGTACAGTTCTAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015271.2-1907s1c1
Sequence:CCGGGCACATTATTGTTGTGGACAACTCGAGTTGTCCACAACAATAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015271.2-371s1c1
Sequence:CCGGCGCGCTCCAGAACAATTTCTTCTCGAGAAGAAATTGTTCTGGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015271.2-1482s1c1
Sequence:CCGGGTCAAGCAGAAAGCTGTGAAACTCGAGTTTCACAGCTTTCTGCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015271.2-742s1c1
Sequence:CCGGGCATCGTGGATGACATTCATTCTCGAGAATGAATGTCATCCACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015271.3-1104s21c1
Sequence:CCGGACAACCTCGGGACGATCTTAACTCGAGTTAAGATCGTCCCGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015271.3-2425s21c1
Sequence:CCGGTCCATGGTCTTGCACTATAAACTCGAGTTTATAGTGCAAGACCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015271.3-1502s21c1
Sequence:CCGGGTCAAGCAGAAAGCTGTGAAACTCGAGTTTCACAGCTTTCTGCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015271.3-391s21c1
Sequence:CCGGCGCGCTCCAGAACAATTTCTTCTCGAGAAGAAATTGTTCTGGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015271.3-2252s21c1
Sequence:CCGGTTTGATGGGAGTGGATCATTTCTCGAGAAATGATCCACTCCCATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015271
VALIDATED
TRIM2 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015271.2-4029s1c1
Sequence:CCGGGCACCTTAGAACTGTACTATACTCGAGTATAGTACAGTTCTAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015271.2-1907s1c1
Sequence:CCGGGCACATTATTGTTGTGGACAACTCGAGTTGTCCACAACAATAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015271.2-371s1c1
Sequence:CCGGCGCGCTCCAGAACAATTTCTTCTCGAGAAGAAATTGTTCTGGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015271.2-1482s1c1
Sequence:CCGGGTCAAGCAGAAAGCTGTGAAACTCGAGTTTCACAGCTTTCTGCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015271.2-742s1c1
Sequence:CCGGGCATCGTGGATGACATTCATTCTCGAGAATGAATGTCATCCACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015271.3-1104s21c1
Sequence:CCGGACAACCTCGGGACGATCTTAACTCGAGTTAAGATCGTCCCGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015271.3-2425s21c1
Sequence:CCGGTCCATGGTCTTGCACTATAAACTCGAGTTTATAGTGCAAGACCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015271.3-1502s21c1
Sequence:CCGGGTCAAGCAGAAAGCTGTGAAACTCGAGTTTCACAGCTTTCTGCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015271.3-391s21c1
Sequence:CCGGCGCGCTCCAGAACAATTTCTTCTCGAGAAGAAATTGTTCTGGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015271.3-2252s21c1
Sequence:CCGGTTTGATGGGAGTGGATCATTTCTCGAGAAATGATCCACTCCCATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks