EMAIL THIS PAGE TO A FRIEND

TRIM31

tripartite motif containing 31

Synonyms: C6orf13 HCG1 HCGI RNF
Gene ID:
Human(11074) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to both the cytoplasm and the nucleus. Its function has not been identified. [provided by RefSeq, Jul 2008]
Mouse(224762) tripartite motif-containing 31
Rat(294208) tripartite motif-containing 31
cow(517666) tripartite motif containing 31
sheep(101112266) tripartite motif containing 31
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146077 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146077 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146077 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007028 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007028 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007028 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112851 MISSION® esiRNA esiRNA human BX322644.8-201 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007028 Rosetta Predictions human pricing
NM_052816 Rosetta Predictions human pricing
NM_001106376 Rosetta Predictions rat pricing
NM_146077 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007028 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342797 predicted 771
2 SASI_Hs02_00342798 predicted 712
3 SASI_Hs01_00214861 predicted 1489
4 SASI_Hs01_00214862 predicted 576
5 SASI_Hs01_00214863 predicted 544
6 SASI_Hs02_00342799 predicted 1224
7 SASI_Hs01_00214864 predicted 1243
8 SASI_Hs02_00342800 predicted 1466
9 SASI_Hs02_00342801 predicted 415
10 SASI_Hs01_00214866 predicted 298
11 SASI_Hs01_00214860 predicted 1742
12 SASI_Hs01_00214865 predicted 483
13 SASI_Hs01_00214867 predicted 295
14 SASI_Hs01_00214868 predicted 218
15 SASI_Hs01_00214869 predicted 1639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052816 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160263 predicted 358
2 SASI_Hs01_00160264 predicted 215
3 SASI_Hs01_00160265 predicted 572
4 SASI_Hs01_00160266 predicted 400
5 SASI_Hs01_00160267 predicted 546
6 SASI_Hs01_00160268 predicted 1168
7 SASI_Hs01_00160269 predicted 1172
8 SASI_Hs01_00160270 predicted 1271
9 SASI_Hs01_00160271 predicted 299
10 SASI_Hs01_00160272 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106376 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218358 predicted 342
2 SASI_Rn02_00218359 predicted 952
3 SASI_Rn02_00218360 predicted 1291
4 SASI_Rn02_00218361 predicted 1717
5 SASI_Rn02_00218362 predicted 452
6 SASI_Rn02_00218363 predicted 501
7 SASI_Rn02_00218364 predicted 954
8 SASI_Rn02_00218365 predicted 1661
9 SASI_Rn02_00218366 predicted 1288
10 SASI_Rn02_00218367 predicted 947
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146077 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132660 predicted 954
2 SASI_Mm01_00132661 predicted 1086
3 SASI_Mm01_00132662 predicted 390
4 SASI_Mm01_00132665 predicted 1832
5 SASI_Mm01_00132666 predicted 329
6 SASI_Mm02_00341709 predicted 1649
7 SASI_Mm01_00132667 predicted 1710
8 SASI_Mm01_00132668 predicted 848
9 SASI_Mm01_00132669 predicted 1804
10 SASI_Mm02_00341710 predicted 320
11 SASI_Mm01_00132663 predicted 1755
12 SASI_Mm01_00132664 predicted 1187
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146077
TRIM31 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 31
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146077.1-1062s1c1
Sequence:CCGGGCAAGGCATGAGTCCATCATACTCGAGTATGATGGACTCATGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146077.1-852s1c1
Sequence:CCGGGCCAAGCAGTTGAGACAATATCTCGAGATATTGTCTCAACTGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146077.1-1670s1c1
Sequence:CCGGCCAAACTTCCTTTGACGGGAACTCGAGTTCCCGTCAAAGGAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146077.1-1291s1c1
Sequence:CCGGCCTTGTATATTGTAGCTGGAACTCGAGTTCCAGCTACAATATACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146077.1-626s1c1
Sequence:CCGGCCAGAACTACAAGGTGCAGATCTCGAGATCTGCACCTTGTAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146077
TRIM31 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 31
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146077.1-1062s1c1
Sequence:CCGGGCAAGGCATGAGTCCATCATACTCGAGTATGATGGACTCATGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146077.1-852s1c1
Sequence:CCGGGCCAAGCAGTTGAGACAATATCTCGAGATATTGTCTCAACTGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146077.1-1670s1c1
Sequence:CCGGCCAAACTTCCTTTGACGGGAACTCGAGTTCCCGTCAAAGGAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146077.1-1291s1c1
Sequence:CCGGCCTTGTATATTGTAGCTGGAACTCGAGTTCCAGCTACAATATACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146077.1-626s1c1
Sequence:CCGGCCAGAACTACAAGGTGCAGATCTCGAGATCTGCACCTTGTAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146077
TRIM31 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 31
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146077.1-1062s1c1
Sequence:CCGGGCAAGGCATGAGTCCATCATACTCGAGTATGATGGACTCATGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146077.1-852s1c1
Sequence:CCGGGCCAAGCAGTTGAGACAATATCTCGAGATATTGTCTCAACTGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146077.1-1670s1c1
Sequence:CCGGCCAAACTTCCTTTGACGGGAACTCGAGTTCCCGTCAAAGGAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146077.1-1291s1c1
Sequence:CCGGCCTTGTATATTGTAGCTGGAACTCGAGTTCCAGCTACAATATACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146077.1-626s1c1
Sequence:CCGGCCAGAACTACAAGGTGCAGATCTCGAGATCTGCACCTTGTAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007028
TRIM31 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 31
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000033769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007028.2-777s1c1
Sequence:CCGGGCCACAGTTGAACGATCTCAACTCGAGTTGAGATCGTTCAACTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007028.2-463s1c1
Sequence:CCGGCGTGAATCCAAGGACCACAAACTCGAGTTTGTGGTCCTTGGATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007028.2-219s1c1
Sequence:CCGGCCTCAAATGCATCACTCAGATCTCGAGATCTGAGTGATGCATTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007028.2-1277s1c1
Sequence:CCGGGCTCTCAGGATACGAAGACATCTCGAGATGTCTTCGTATCCTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007028
TRIM31 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 31
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000033769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007028.2-777s1c1
Sequence:CCGGGCCACAGTTGAACGATCTCAACTCGAGTTGAGATCGTTCAACTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007028.2-463s1c1
Sequence:CCGGCGTGAATCCAAGGACCACAAACTCGAGTTTGTGGTCCTTGGATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007028.2-219s1c1
Sequence:CCGGCCTCAAATGCATCACTCAGATCTCGAGATCTGAGTGATGCATTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007028.2-1277s1c1
Sequence:CCGGGCTCTCAGGATACGAAGACATCTCGAGATGTCTTCGTATCCTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007028
TRIM31 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 31
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000033769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007028.2-777s1c1
Sequence:CCGGGCCACAGTTGAACGATCTCAACTCGAGTTGAGATCGTTCAACTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007028.2-463s1c1
Sequence:CCGGCGTGAATCCAAGGACCACAAACTCGAGTTTGTGGTCCTTGGATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007028.2-219s1c1
Sequence:CCGGCCTCAAATGCATCACTCAGATCTCGAGATCTGAGTGATGCATTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007028.2-1277s1c1
Sequence:CCGGGCTCTCAGGATACGAAGACATCTCGAGATGTCTTCGTATCCTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks