EMAIL THIS PAGE TO A FRIEND

TRIM32

tripartite motif containing 32

Synonyms: BBS11 HT2A LGMD2H TATIP
UniProtKB ID: Q13049, Q9NQP8
Gene ID:
Human(22954) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. The protein has also been localized to the nucleus, where it interacts with the activation domain of the HIV-1 Tat protein. The Tat protein activates transcription of HIV-1 genes. [provided by RefSeq, Jul 2008]
Mouse(69807) tripartite motif-containing 32
Rat(313264) tripartite motif-containing 32
Zebrafish(562764) tripartite motif-containing 32
chicken(101666930) tripartite motif containing 32
domestic cat(101084580) tripartite motif containing 32
Horse(100066864) tripartite motif containing 32
dog(610956) tripartite motif containing 32
chicken(101748429) tripartite motif containing 32
domestic guinea pig(100725075) tripartite motif containing 32
naked mole-rat(101716496) tripartite motif containing 32
Domestic Rabbit(100341307) tripartite motif containing 32
cow(521975) tripartite motif containing 32
sheep(101117567) tripartite motif containing 32
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012210 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012210 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012210 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053084 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053084 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053084 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099679 Rosetta Predictions human pricing
NM_012210 Rosetta Predictions human pricing
NM_001012103 Rosetta Predictions rat pricing
NM_053084 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321038 predicted 385
2 SASI_Hs02_00321039 predicted 556
3 SASI_Hs02_00321040 predicted 1279
4 SASI_Hs02_00321041 predicted 1634
5 SASI_Hs02_00321042 predicted 1325
6 SASI_Hs02_00321043 predicted 778
7 SASI_Hs02_00321044 predicted 300
8 SASI_Hs02_00321045 predicted 1395
9 SASI_Hs02_00321046 predicted 1492
10 SASI_Hs02_00321047 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128629 predicted 392
2 SASI_Hs01_00128630 predicted 550
3 SASI_Hs01_00128631 predicted 1282
4 SASI_Hs01_00128632 predicted 1639
5 SASI_Hs02_00343871 predicted 1328
6 SASI_Hs02_00343872 predicted 782
7 SASI_Hs01_00128634 predicted 309
8 SASI_Hs01_00128636 predicted 1389
9 SASI_Hs02_00343873 predicted 1498
10 SASI_Hs02_00343874 predicted 478
11 SASI_Hs01_00128628 predicted 1304
12 SASI_Hs01_00128633 predicted 2103
13 SASI_Hs01_00128635 predicted 2158
14 SASI_Hs01_00128637 predicted 2051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012103 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040238 predicted 1420
2 SASI_Rn01_00040239 predicted 873
3 SASI_Rn02_00200248 predicted 1582
4 SASI_Rn01_00040240 predicted 653
5 SASI_Rn01_00040241 predicted 847
6 SASI_Rn01_00040242 predicted 1684
7 SASI_Rn02_00200249 predicted 640
8 SASI_Rn01_00040243 predicted 1909
9 SASI_Rn01_00040244 predicted 475
10 SASI_Rn01_00040246 predicted 201
11 SASI_Rn01_00040237 predicted 2169
12 SASI_Rn01_00040245 predicted 1827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053084 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046476 predicted 1427
2 SASI_Mm01_00046477 predicted 1609
3 SASI_Mm01_00046478 predicted 840
4 SASI_Mm01_00046479 predicted 1682
5 SASI_Mm01_00046480 predicted 1366
6 SASI_Mm01_00046482 predicted 1322
7 SASI_Mm02_00337570 predicted 1910
8 SASI_Mm01_00046483 predicted 1454
9 SASI_Mm02_00337571 predicted 1690
10 SASI_Mm01_00046484 predicted 1472
11 SASI_Mm01_00046481 predicted 1422
12 SASI_Mm01_00046485 predicted 1907
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012210
VALIDATED
TRIM32 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 32
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012210.x-1643s1c1
Sequence:CCGGGTGGTCAAATACAGCTGCCTACTCGAGTAGGCAGCTGTATTTGACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_012210.x-665s1c1
Sequence:CCGGCAGGCAAGGTATAAAGCAGTTCTCGAGAACTGCTTTATACCTTGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_012210.x-2028s1c1
Sequence:CCGGTCTTGGACTGTTGGGATCATTCTCGAGAATGATCCCAACAGTCCAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012210.x-375s1c1
Sequence:CCGGCAGTGCTAAAGATCATTGATACTCGAGTATCAATGATCTTTAGCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_012210.x-3098s1c1
Sequence:CCGGCCATTTCTCTATCAAGCATTACTCGAGTAATGCTTGATAGAGAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_012210.3-1507s21c1
Sequence:CCGGATAACTCCCTCAAGGTATATACTCGAGTATATACCTTGAGGGAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012210.3-3126s21c1
Sequence:CCGGCCATTTCTCTATCAAGCATTACTCGAGTAATGCTTGATAGAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_012210.3-1326s21c1
Sequence:CCGGGACCGTGGTAACTATCGTATACTCGAGTATACGATAGTTACCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_012210.3-794s21c1
Sequence:CCGGTGAAGTTGAGAAGTCCAATAGCTCGAGCTATTGGACTTCTCAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_012210.3-1858s21c1
Sequence:CCGGGCCACTTCTTCTCGGAGAATGCTCGAGCATTCTCCGAGAAGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012210
VALIDATED
TRIM32 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 32
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012210.x-1643s1c1
Sequence:CCGGGTGGTCAAATACAGCTGCCTACTCGAGTAGGCAGCTGTATTTGACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_012210.x-665s1c1
Sequence:CCGGCAGGCAAGGTATAAAGCAGTTCTCGAGAACTGCTTTATACCTTGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_012210.x-2028s1c1
Sequence:CCGGTCTTGGACTGTTGGGATCATTCTCGAGAATGATCCCAACAGTCCAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012210.x-375s1c1
Sequence:CCGGCAGTGCTAAAGATCATTGATACTCGAGTATCAATGATCTTTAGCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_012210.x-3098s1c1
Sequence:CCGGCCATTTCTCTATCAAGCATTACTCGAGTAATGCTTGATAGAGAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_012210.3-1507s21c1
Sequence:CCGGATAACTCCCTCAAGGTATATACTCGAGTATATACCTTGAGGGAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012210.3-3126s21c1
Sequence:CCGGCCATTTCTCTATCAAGCATTACTCGAGTAATGCTTGATAGAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_012210.3-1326s21c1
Sequence:CCGGGACCGTGGTAACTATCGTATACTCGAGTATACGATAGTTACCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_012210.3-794s21c1
Sequence:CCGGTGAAGTTGAGAAGTCCAATAGCTCGAGCTATTGGACTTCTCAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_012210.3-1858s21c1
Sequence:CCGGGCCACTTCTTCTCGGAGAATGCTCGAGCATTCTCCGAGAAGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012210
VALIDATED
TRIM32 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 32
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012210.x-1643s1c1
Sequence:CCGGGTGGTCAAATACAGCTGCCTACTCGAGTAGGCAGCTGTATTTGACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_012210.x-665s1c1
Sequence:CCGGCAGGCAAGGTATAAAGCAGTTCTCGAGAACTGCTTTATACCTTGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_012210.x-2028s1c1
Sequence:CCGGTCTTGGACTGTTGGGATCATTCTCGAGAATGATCCCAACAGTCCAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012210.x-375s1c1
Sequence:CCGGCAGTGCTAAAGATCATTGATACTCGAGTATCAATGATCTTTAGCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_012210.x-3098s1c1
Sequence:CCGGCCATTTCTCTATCAAGCATTACTCGAGTAATGCTTGATAGAGAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_012210.3-1507s21c1
Sequence:CCGGATAACTCCCTCAAGGTATATACTCGAGTATATACCTTGAGGGAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012210.3-3126s21c1
Sequence:CCGGCCATTTCTCTATCAAGCATTACTCGAGTAATGCTTGATAGAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_012210.3-1326s21c1
Sequence:CCGGGACCGTGGTAACTATCGTATACTCGAGTATACGATAGTTACCACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_012210.3-794s21c1
Sequence:CCGGTGAAGTTGAGAAGTCCAATAGCTCGAGCTATTGGACTTCTCAACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_012210.3-1858s21c1
Sequence:CCGGGCCACTTCTTCTCGGAGAATGCTCGAGCATTCTCCGAGAAGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053084
VALIDATED
TRIM32 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 32
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053084.1-1921s1c1
Sequence:CCGGGCCGCAAGGAAATTCTCCATTCTCGAGAATGGAGAATTTCCTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053084.1-185s1c1
Sequence:CCGGGCTAGAATGTCCCATCTGCATCTCGAGATGCAGATGGGACATTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053084.1-2068s1c1
Sequence:CCGGGCTATCATCTGAGAAGATATTCTCGAGAATATCTTCTCAGATGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053084.1-1375s1c1
Sequence:CCGGGCATTGATAGCTTCGTGCTAACTCGAGTTAGCACGAAGCTATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053084.1-1683s1c1
Sequence:CCGGCCCAAGTTTGTCACCTGTGATCTCGAGATCACAGGTGACAAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053084.1-1921s21c1
Sequence:CCGGGCCGCAAGGAAATTCTCCATTCTCGAGAATGGAGAATTTCCTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053084.1-185s21c1
Sequence:CCGGGCTAGAATGTCCCATCTGCATCTCGAGATGCAGATGGGACATTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053084.1-2068s21c1
Sequence:CCGGGCTATCATCTGAGAAGATATTCTCGAGAATATCTTCTCAGATGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053084.1-1683s21c1
Sequence:CCGGCCCAAGTTTGTCACCTGTGATCTCGAGATCACAGGTGACAAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053084.1-1375s21c1
Sequence:CCGGGCATTGATAGCTTCGTGCTAACTCGAGTTAGCACGAAGCTATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053084
VALIDATED
TRIM32 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 32
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053084.1-1921s1c1
Sequence:CCGGGCCGCAAGGAAATTCTCCATTCTCGAGAATGGAGAATTTCCTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053084.1-185s1c1
Sequence:CCGGGCTAGAATGTCCCATCTGCATCTCGAGATGCAGATGGGACATTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053084.1-2068s1c1
Sequence:CCGGGCTATCATCTGAGAAGATATTCTCGAGAATATCTTCTCAGATGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053084.1-1375s1c1
Sequence:CCGGGCATTGATAGCTTCGTGCTAACTCGAGTTAGCACGAAGCTATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053084.1-1683s1c1
Sequence:CCGGCCCAAGTTTGTCACCTGTGATCTCGAGATCACAGGTGACAAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053084.1-1921s21c1
Sequence:CCGGGCCGCAAGGAAATTCTCCATTCTCGAGAATGGAGAATTTCCTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053084.1-185s21c1
Sequence:CCGGGCTAGAATGTCCCATCTGCATCTCGAGATGCAGATGGGACATTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053084.1-2068s21c1
Sequence:CCGGGCTATCATCTGAGAAGATATTCTCGAGAATATCTTCTCAGATGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053084.1-1683s21c1
Sequence:CCGGCCCAAGTTTGTCACCTGTGATCTCGAGATCACAGGTGACAAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053084.1-1375s21c1
Sequence:CCGGGCATTGATAGCTTCGTGCTAACTCGAGTTAGCACGAAGCTATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053084
VALIDATED
TRIM32 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 32
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053084.1-1921s1c1
Sequence:CCGGGCCGCAAGGAAATTCTCCATTCTCGAGAATGGAGAATTTCCTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053084.1-185s1c1
Sequence:CCGGGCTAGAATGTCCCATCTGCATCTCGAGATGCAGATGGGACATTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053084.1-2068s1c1
Sequence:CCGGGCTATCATCTGAGAAGATATTCTCGAGAATATCTTCTCAGATGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053084.1-1375s1c1
Sequence:CCGGGCATTGATAGCTTCGTGCTAACTCGAGTTAGCACGAAGCTATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053084.1-1683s1c1
Sequence:CCGGCCCAAGTTTGTCACCTGTGATCTCGAGATCACAGGTGACAAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053084.1-1921s21c1
Sequence:CCGGGCCGCAAGGAAATTCTCCATTCTCGAGAATGGAGAATTTCCTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053084.1-185s21c1
Sequence:CCGGGCTAGAATGTCCCATCTGCATCTCGAGATGCAGATGGGACATTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053084.1-2068s21c1
Sequence:CCGGGCTATCATCTGAGAAGATATTCTCGAGAATATCTTCTCAGATGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053084.1-1683s21c1
Sequence:CCGGCCCAAGTTTGTCACCTGTGATCTCGAGATCACAGGTGACAAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053084.1-1375s21c1
Sequence:CCGGGCATTGATAGCTTCGTGCTAACTCGAGTTAGCACGAAGCTATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks