EMAIL THIS PAGE TO A FRIEND

TRIM33

tripartite motif containing 33

Synonyms: ECTO PTC7 RFG7 TF1G TIF1G TIF1GAMMA TIFGAMMA
Gene ID:
Human(51592) Summary: The protein encoded by this gene is thought to be a transcriptional corepressor. However, molecules that interact with this protein have not yet been identified. The protein is a member of the tripartite motif family. This motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. Three alternatively spliced transcript variants for this gene have been described, however, the full-length nature of one variant has not been determined. [provided by RefSeq, Jul 2008]
Mouse(94093) tripartite motif-containing 33
Rat(365894) tripartite motif-containing 33
cow(533296) tripartite motif containing 33
sheep(101122480) tripartite motif containing 33
naked mole-rat(101718021) tripartite motif containing 33
domestic guinea pig(100719836) tripartite motif containing 33
Zebrafish(324053) tripartite motif-containing 33
Horse(100065226) tripartite motif containing 33
domestic cat(101099107) tripartite motif containing 33
dog(475804) tripartite motif containing 33
chicken(419883) tripartite motif containing 33
295 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015906 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015906 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015906 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053170 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053170 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053170 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157121 MISSION® esiRNA esiRNA human TRIM33 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015906 Rosetta Predictions human pricing
NM_033020 Rosetta Predictions human pricing
XM_001064293 Rosetta Predictions rat pricing
XM_001064349 Rosetta Predictions rat pricing
XM_001064397 Rosetta Predictions rat pricing
XM_345266 Rosetta Predictions rat pricing
NM_001079830 Rosetta Predictions mouse pricing
NM_053170 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015906 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180277 predicted 2389
2 SASI_Hs01_00180278 predicted 1247
3 SASI_Hs01_00180279 predicted 1053
4 SASI_Hs01_00180280 predicted 2138
5 SASI_Hs01_00180281 predicted 653
6 SASI_Hs02_00348501 predicted 2106
7 SASI_Hs01_00180282 predicted 1477
8 SASI_Hs02_00348502 predicted 1140
9 SASI_Hs01_00180283 predicted 606
10 SASI_Hs02_00348503 predicted 2871
11 SASI_Hs01_00180284 predicted 2673
12 SASI_Hs01_00180285 predicted 2609
13 SASI_Hs01_00180286 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033020 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225254 predicted 2385
2 SASI_Hs01_00225255 predicted 1246
3 SASI_Hs01_00225256 predicted 1048
4 SASI_Hs01_00225257 predicted 2144
5 SASI_Hs01_00225258 predicted 648
6 SASI_Hs02_00360689 predicted 2103
7 SASI_Hs01_00225259 predicted 1474
8 SASI_Hs02_00360690 predicted 1148
9 SASI_Hs01_00225260 predicted 610
10 SASI_Hs02_00360691 predicted 2872
11 SASI_Hs01_00225261 predicted 2676
12 SASI_Hs01_00225262 predicted 2615
13 SASI_Hs01_00225263 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064293 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309940 predicted 2755
2 SASI_Rn02_00309941 predicted 2062
3 SASI_Rn02_00309942 predicted 2677
4 SASI_Rn02_00309943 predicted 658
5 SASI_Rn02_00309944 predicted 2850
6 SASI_Rn02_00309945 predicted 899
7 SASI_Rn02_00309946 predicted 2209
8 SASI_Rn02_00309947 predicted 1962
9 SASI_Rn02_00309948 predicted 2767
10 SASI_Rn02_00309949 predicted 2945
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064349 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310121 predicted 3621
2 SASI_Rn02_00310122 predicted 2941
3 SASI_Rn02_00310123 predicted 3552
4 SASI_Rn02_00310124 predicted 1530
5 SASI_Rn02_00310125 predicted 3758
6 SASI_Rn02_00310126 predicted 3088
7 SASI_Rn02_00310127 predicted 3732
8 SASI_Rn02_00310128 predicted 2829
9 SASI_Rn02_00310129 predicted 3642
10 SASI_Rn02_00310130 predicted 3871
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064397 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310304 predicted 3060
2 SASI_Rn02_00310305 predicted 2379
3 SASI_Rn02_00310306 predicted 2986
4 SASI_Rn02_00310307 predicted 965
5 SASI_Rn02_00310308 predicted 3160
6 SASI_Rn02_00310309 predicted 1207
7 SASI_Rn02_00310310 predicted 2518
8 SASI_Rn02_00310311 predicted 2270
9 SASI_Rn02_00310312 predicted 3082
10 SASI_Rn02_00310313 predicted 3248
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345266 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398134 predicted 3626
2 SASI_Rn02_00398135 predicted 2942
3 SASI_Rn02_00398136 predicted 3553
4 SASI_Rn02_00398137 predicted 1536
5 SASI_Rn02_00398138 predicted 3754
6 SASI_Rn02_00398139 predicted 1779
7 SASI_Rn02_00398140 predicted 3088
8 SASI_Rn02_00398141 predicted 3728
9 SASI_Rn02_00398142 predicted 2830
10 SASI_Rn02_00398143 predicted 3648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079830 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293082 predicted 2599
2 SASI_Mm02_00293083 predicted 1188
3 SASI_Mm02_00293084 predicted 1901
4 SASI_Mm02_00293085 predicted 2816
5 SASI_Mm02_00293086 predicted 3351
6 SASI_Mm02_00293087 predicted 4026
7 SASI_Mm02_00293088 predicted 3203
8 SASI_Mm02_00293089 predicted 2447
9 SASI_Mm02_00293090 predicted 2138
10 SASI_Mm02_00293091 predicted 2047
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053170 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337723 predicted 2600
2 SASI_Mm02_00337724 predicted 1191
3 SASI_Mm01_00131333 predicted 1906
4 SASI_Mm02_00337725 predicted 2822
5 SASI_Mm02_00337726 predicted 3358
6 SASI_Mm01_00131335 predicted 4080
7 SASI_Mm01_00131337 predicted 3198
8 SASI_Mm01_00131338 predicted 2446
9 SASI_Mm01_00131339 predicted 2143
10 SASI_Mm01_00131340 predicted 2038
11 SASI_Mm01_00131332 predicted 3731
12 SASI_Mm01_00131334 predicted 3553
13 SASI_Mm01_00131336 predicted 3865
14 SASI_Mm01_00131341 predicted 2712
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015906
VALIDATED
TRIM33 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 33
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015906.3-1389s21c1
Sequence:CCGGTACTTTCCAGTTGCGTCATATCTCGAGATATGACGCAACTGGAAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015906.3-2152s21c1
Sequence:CCGGGATGCTGGCTCAAGTAGTTTACTCGAGTAAACTACTTGAGCCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015906.3-3049s21c1
Sequence:CCGGTCGATACCAAACTACTATAAACTCGAGTTTATAGTAGTTTGGTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015906.3-3286s21c1
Sequence:CCGGGCAGTTGCATTGTACTTTGAACTCGAGTTCAAAGTACAATGCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015906.2-1380s1c1
Sequence:CCGGGCGACTGATTACTTTCCAGTTCTCGAGAACTGGAAAGTAATCAGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015906.2-1531s1c1
Sequence:CCGGGCTCCTGGTTATACTCCTAATCTCGAGATTAGGAGTATAACCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015906.2-2089s1c1
Sequence:CCGGCCCTCAGTTACCAATCCAGAACTCGAGTTCTGGATTGGTAACTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015906.2-1902s1c1
Sequence:CCGGCGGCCCTCAATATTCCATGATCTCGAGATCATGGAATATTGAGGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015906.2-3286s1c1
Sequence:CCGGGCAGTTGCATTGTACTTTGAACTCGAGTTCAAAGTACAATGCAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015906.3-2060s1c1
Sequence:CCGGGCCCATCTGTTACAGCAATAGCTCGAGCTATTGCTGTAACAGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015906.3-734s1c1
Sequence:CCGGGTACTAGTTGTGAAGACAATGCTCGAGCATTGTCTTCACAACTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015906.3-2159s1c1
Sequence:CCGGGCTCAAGTAGTTTAGATAATCCTCGAGGATTATCTAAACTACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015906
VALIDATED
TRIM33 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 33
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015906.3-1389s21c1
Sequence:CCGGTACTTTCCAGTTGCGTCATATCTCGAGATATGACGCAACTGGAAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015906.3-2152s21c1
Sequence:CCGGGATGCTGGCTCAAGTAGTTTACTCGAGTAAACTACTTGAGCCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015906.3-3049s21c1
Sequence:CCGGTCGATACCAAACTACTATAAACTCGAGTTTATAGTAGTTTGGTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015906.3-3286s21c1
Sequence:CCGGGCAGTTGCATTGTACTTTGAACTCGAGTTCAAAGTACAATGCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015906.2-1380s1c1
Sequence:CCGGGCGACTGATTACTTTCCAGTTCTCGAGAACTGGAAAGTAATCAGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015906.2-1531s1c1
Sequence:CCGGGCTCCTGGTTATACTCCTAATCTCGAGATTAGGAGTATAACCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015906.2-2089s1c1
Sequence:CCGGCCCTCAGTTACCAATCCAGAACTCGAGTTCTGGATTGGTAACTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015906.2-1902s1c1
Sequence:CCGGCGGCCCTCAATATTCCATGATCTCGAGATCATGGAATATTGAGGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015906.2-3286s1c1
Sequence:CCGGGCAGTTGCATTGTACTTTGAACTCGAGTTCAAAGTACAATGCAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015906.3-2060s1c1
Sequence:CCGGGCCCATCTGTTACAGCAATAGCTCGAGCTATTGCTGTAACAGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015906.3-734s1c1
Sequence:CCGGGTACTAGTTGTGAAGACAATGCTCGAGCATTGTCTTCACAACTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015906.3-2159s1c1
Sequence:CCGGGCTCAAGTAGTTTAGATAATCCTCGAGGATTATCTAAACTACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015906
VALIDATED
TRIM33 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 33
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015906.3-1389s21c1
Sequence:CCGGTACTTTCCAGTTGCGTCATATCTCGAGATATGACGCAACTGGAAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015906.3-2152s21c1
Sequence:CCGGGATGCTGGCTCAAGTAGTTTACTCGAGTAAACTACTTGAGCCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015906.3-3049s21c1
Sequence:CCGGTCGATACCAAACTACTATAAACTCGAGTTTATAGTAGTTTGGTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015906.3-3286s21c1
Sequence:CCGGGCAGTTGCATTGTACTTTGAACTCGAGTTCAAAGTACAATGCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015906.2-1380s1c1
Sequence:CCGGGCGACTGATTACTTTCCAGTTCTCGAGAACTGGAAAGTAATCAGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015906.2-1531s1c1
Sequence:CCGGGCTCCTGGTTATACTCCTAATCTCGAGATTAGGAGTATAACCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015906.2-2089s1c1
Sequence:CCGGCCCTCAGTTACCAATCCAGAACTCGAGTTCTGGATTGGTAACTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015906.2-1902s1c1
Sequence:CCGGCGGCCCTCAATATTCCATGATCTCGAGATCATGGAATATTGAGGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015906.2-3286s1c1
Sequence:CCGGGCAGTTGCATTGTACTTTGAACTCGAGTTCAAAGTACAATGCAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015906.3-2060s1c1
Sequence:CCGGGCCCATCTGTTACAGCAATAGCTCGAGCTATTGCTGTAACAGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015906.3-734s1c1
Sequence:CCGGGTACTAGTTGTGAAGACAATGCTCGAGCATTGTCTTCACAACTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015906.3-2159s1c1
Sequence:CCGGGCTCAAGTAGTTTAGATAATCCTCGAGGATTATCTAAACTACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053170
VALIDATED
TRIM33 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 33
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053170.2-1497s21c1
Sequence:CCGGCGTGTGATAGATTGACGTGTACTCGAGTACACGTCAATCTATCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053170.2-3540s21c1
Sequence:CCGGACCTCTATTGTCACGAATTAACTCGAGTTAATTCGTGACAATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053170.2-4017s21c1
Sequence:CCGGCGGACTTAAATCGGTTGTTAACTCGAGTTAACAACCGATTTAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053170.2-2918s21c1
Sequence:CCGGGCTCATAGTTTCAAGTCTGATCTCGAGATCAGACTTGAAACTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053170.2-3590s21c1
Sequence:CCGGTCGATACCAAACTACTATAAACTCGAGTTTATAGTAGTTTGGTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053170.1-2610s1c1
Sequence:CCGGCGTCTGTTACAGCAATAGAATCTCGAGATTCTATTGCTGTAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053170.1-2924s1c1
Sequence:CCGGGCTCATAGTTTCAAGTCTGATCTCGAGATCAGACTTGAAACTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053170.1-1652s1c1
Sequence:CCGGGCAGCTACACAAGTGCAGAATCTCGAGATTCTGCACTTGTGTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053170.1-2681s1c1
Sequence:CCGGCCACCTATACAGTTGGAAGATCTCGAGATCTTCCAACTGTATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053170.1-1503s1c1
Sequence:CCGGCGTGTGATAGATTGACGTGTACTCGAGTACACGTCAATCTATCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053170
VALIDATED
TRIM33 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 33
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053170.2-1497s21c1
Sequence:CCGGCGTGTGATAGATTGACGTGTACTCGAGTACACGTCAATCTATCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053170.2-3540s21c1
Sequence:CCGGACCTCTATTGTCACGAATTAACTCGAGTTAATTCGTGACAATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053170.2-4017s21c1
Sequence:CCGGCGGACTTAAATCGGTTGTTAACTCGAGTTAACAACCGATTTAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053170.2-2918s21c1
Sequence:CCGGGCTCATAGTTTCAAGTCTGATCTCGAGATCAGACTTGAAACTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053170.2-3590s21c1
Sequence:CCGGTCGATACCAAACTACTATAAACTCGAGTTTATAGTAGTTTGGTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053170.1-2610s1c1
Sequence:CCGGCGTCTGTTACAGCAATAGAATCTCGAGATTCTATTGCTGTAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053170.1-2924s1c1
Sequence:CCGGGCTCATAGTTTCAAGTCTGATCTCGAGATCAGACTTGAAACTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053170.1-1652s1c1
Sequence:CCGGGCAGCTACACAAGTGCAGAATCTCGAGATTCTGCACTTGTGTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053170.1-2681s1c1
Sequence:CCGGCCACCTATACAGTTGGAAGATCTCGAGATCTTCCAACTGTATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053170.1-1503s1c1
Sequence:CCGGCGTGTGATAGATTGACGTGTACTCGAGTACACGTCAATCTATCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053170
VALIDATED
TRIM33 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 33
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053170.2-1497s21c1
Sequence:CCGGCGTGTGATAGATTGACGTGTACTCGAGTACACGTCAATCTATCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053170.2-3540s21c1
Sequence:CCGGACCTCTATTGTCACGAATTAACTCGAGTTAATTCGTGACAATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053170.2-4017s21c1
Sequence:CCGGCGGACTTAAATCGGTTGTTAACTCGAGTTAACAACCGATTTAAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053170.2-2918s21c1
Sequence:CCGGGCTCATAGTTTCAAGTCTGATCTCGAGATCAGACTTGAAACTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_053170.2-3590s21c1
Sequence:CCGGTCGATACCAAACTACTATAAACTCGAGTTTATAGTAGTTTGGTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053170.1-2610s1c1
Sequence:CCGGCGTCTGTTACAGCAATAGAATCTCGAGATTCTATTGCTGTAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053170.1-2924s1c1
Sequence:CCGGGCTCATAGTTTCAAGTCTGATCTCGAGATCAGACTTGAAACTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053170.1-1652s1c1
Sequence:CCGGGCAGCTACACAAGTGCAGAATCTCGAGATTCTGCACTTGTGTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053170.1-2681s1c1
Sequence:CCGGCCACCTATACAGTTGGAAGATCTCGAGATCTTCCAACTGTATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053170.1-1503s1c1
Sequence:CCGGCGTGTGATAGATTGACGTGTACTCGAGTACACGTCAATCTATCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks