EMAIL THIS PAGE TO A FRIEND

TRIM34

tripartite motif containing 34

Synonyms: IFP1 RNF21
UniProtKB ID: Q9BYJ4, D3DQS7, Q9C016, Q9HCR0, Q9HCR1, Q9HCR2
Gene ID:
Human(53840) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, B-box type 1 and B-box type 2 domain, and a coiled-coil region. Expression of this gene is up-regulated by interferon. This gene is mapped to chromosome 11p15, where it resides within a TRIM gene cluster. Alternative splicing results in multiple transcript variants. A read-through transcript from the upstream TRIM6 gene has also been observed, which results in a fusion product from these neighboring family members. [provided by RefSeq, Oct 2010]
Rat(101241893) tripartite motif-containing 34
dog(100568302) tripartite motif containing 34
domestic cat(101095044) tripartite motif containing 34
Horse(100568304) tripartite motif containing 34
domestic guinea pig(100715212) tripartite motif containing 34
naked mole-rat(101721918) tripartite motif containing 34
cow(539820) tripartite motif containing 34
sheep(101102669) tripartite motif containing 34
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021616 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021616 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021616 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003827 Rosetta Predictions human pricing
NM_021616 Rosetta Predictions human pricing
NM_130389 Rosetta Predictions human pricing
NM_130390 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220692 predicted 1261
2 SASI_Hs01_00220693 predicted 1062
3 SASI_Hs01_00220694 predicted 1317
4 SASI_Hs01_00220695 predicted 1332
5 SASI_Hs01_00220698 predicted 906
6 SASI_Hs01_00220699 predicted 1171
7 SASI_Hs01_00220700 predicted 1282
8 SASI_Hs01_00220701 predicted 975
9 SASI_Hs02_00304406 predicted 787
10 SASI_Hs02_00304407 predicted 967
11 SASI_Hs01_00220696 predicted 1269
12 SASI_Hs01_00220697 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232022 predicted 1237
2 SASI_Hs01_00232023 predicted 1034
3 SASI_Hs01_00232024 predicted 1292
4 SASI_Hs01_00232025 predicted 1303
5 SASI_Hs01_00232028 predicted 879
6 SASI_Hs01_00232029 predicted 1153
7 SASI_Hs01_00232030 predicted 1254
8 SASI_Hs01_00232031 predicted 952
9 SASI_Hs02_00354950 predicted 944
10 SASI_Hs02_00354951 predicted 1231
11 SASI_Hs01_00232026 predicted 1252
12 SASI_Hs01_00232027 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231932 predicted 1168
2 SASI_Hs01_00231933 predicted 974
3 SASI_Hs01_00231934 predicted 1226
4 SASI_Hs01_00231935 predicted 1244
5 SASI_Hs01_00231938 predicted 812
6 SASI_Hs01_00231939 predicted 1084
7 SASI_Hs01_00231940 predicted 1186
8 SASI_Hs01_00231941 predicted 887
9 SASI_Hs02_00362711 predicted 876
10 SASI_Hs02_00362712 predicted 1166
11 SASI_Hs01_00231936 predicted 1184
12 SASI_Hs01_00231937 predicted 983
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362713 predicted 465
2 SASI_Hs02_00362714 predicted 618
3 SASI_Hs02_00362715 predicted 507
4 SASI_Hs01_00055613 predicted 300
5 SASI_Hs02_00362716 predicted 471
6 SASI_Hs02_00362717 predicted 461
7 SASI_Hs01_00055617 predicted 349
8 SASI_Hs02_00362718 predicted 329
9 SASI_Hs01_00055618 predicted 598
10 SASI_Hs02_00362719 predicted 603
11 SASI_Hs01_00055612 predicted 572
12 SASI_Hs01_00055614 predicted 286
13 SASI_Hs01_00055615 predicted 693
14 SASI_Hs01_00055616 predicted 618
15 SASI_Hs01_00055619 predicted 227
16 SASI_Hs01_00055620 predicted 331
17 SASI_Hs01_00055621 predicted 455
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021616
TRIM34 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 34
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021616.3-1837s1c1
Sequence:CCGGGCCTTCCCATTTATCCATGTTCTCGAGAACATGGATAAATGGGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021616.3-519s1c1
Sequence:CCGGCGGAGGAAGTATTCAAGGAATCTCGAGATTCCTTGAATACTTCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021616.3-295s1c1
Sequence:CCGGGTGTGGTATCAGTTACTCATTCTCGAGAATGAGTAACTGATACCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021616.3-1235s1c1
Sequence:CCGGCGCCATATGAAGTATGTTGTTCTCGAGAACAACATACTTCATATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021616.3-868s1c1
Sequence:CCGGGCAGGACATGAGTGGAATCATCTCGAGATGATTCCACTCATGTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021616.4-1747s21c1
Sequence:CCGGAGTTATGAGAGATGCTTATTTCTCGAGAAATAAGCATCTCTCATAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021616
TRIM34 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 34
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021616.3-1837s1c1
Sequence:CCGGGCCTTCCCATTTATCCATGTTCTCGAGAACATGGATAAATGGGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021616.3-519s1c1
Sequence:CCGGCGGAGGAAGTATTCAAGGAATCTCGAGATTCCTTGAATACTTCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021616.3-295s1c1
Sequence:CCGGGTGTGGTATCAGTTACTCATTCTCGAGAATGAGTAACTGATACCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021616.3-1235s1c1
Sequence:CCGGCGCCATATGAAGTATGTTGTTCTCGAGAACAACATACTTCATATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021616.3-868s1c1
Sequence:CCGGGCAGGACATGAGTGGAATCATCTCGAGATGATTCCACTCATGTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021616.4-1747s21c1
Sequence:CCGGAGTTATGAGAGATGCTTATTTCTCGAGAAATAAGCATCTCTCATAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021616
TRIM34 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 34
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010970    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021616.3-1837s1c1
Sequence:CCGGGCCTTCCCATTTATCCATGTTCTCGAGAACATGGATAAATGGGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021616.3-519s1c1
Sequence:CCGGCGGAGGAAGTATTCAAGGAATCTCGAGATTCCTTGAATACTTCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021616.3-295s1c1
Sequence:CCGGGTGTGGTATCAGTTACTCATTCTCGAGAATGAGTAACTGATACCACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021616.3-1235s1c1
Sequence:CCGGCGCCATATGAAGTATGTTGTTCTCGAGAACAACATACTTCATATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021616.3-868s1c1
Sequence:CCGGGCAGGACATGAGTGGAATCATCTCGAGATGATTCCACTCATGTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021616.4-1747s21c1
Sequence:CCGGAGTTATGAGAGATGCTTATTTCTCGAGAAATAAGCATCTCTCATAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks