EMAIL THIS PAGE TO A FRIEND

TRIM35

tripartite motif containing 35

Synonyms: HLS5 MAIR
UniProtKB ID: Q9UPQ4, Q86XQ0, Q8WVA4
Gene ID:
Human(23087) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The function of this protein has not been identified. [provided by RefSeq, Jul 2008]
Mouse(66854) tripartite motif-containing 35
Rat(498538) tripartite motif-containing 35
cow(518310) tripartite motif containing 35
sheep(101119023) tripartite motif containing 35
naked mole-rat(101714045) tripartite motif containing 35
domestic guinea pig(100734686) tripartite motif containing 35
chicken(771180) tripartite motif containing 35
domestic cat(101091442) tripartite motif containing 35
dog(486103) tripartite motif containing 35
Gene Class: Apoptosis
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029979 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029979 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029979 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015066 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015066 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015066 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU081201 MISSION® esiRNA esiRNA targeting mouse Trim35 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_171982 Rosetta Predictions human pricing
NM_001025142 Rosetta Predictions rat pricing
NM_029979 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_171982 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137994 predicted 965
2 SASI_Hs01_00137995 predicted 729
3 SASI_Hs01_00137996 predicted 1578
4 SASI_Hs01_00137997 predicted 575
5 SASI_Hs01_00137998 predicted 1629
6 SASI_Hs01_00137999 predicted 285
7 SASI_Hs01_00138000 predicted 482
8 SASI_Hs01_00138001 predicted 1620
9 SASI_Hs01_00138002 predicted 730
10 SASI_Hs01_00138003 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025142 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050583 predicted 550
2 SASI_Rn01_00050584 predicted 1814
3 SASI_Rn01_00050585 predicted 999
4 SASI_Rn01_00050586 predicted 626
5 SASI_Rn01_00050587 predicted 1932
6 SASI_Rn01_00050588 predicted 1781
7 SASI_Rn01_00050590 predicted 788
8 SASI_Rn01_00050591 predicted 871
9 SASI_Rn01_00050592 predicted 747
10 SASI_Rn02_00203068 predicted 617
11 SASI_Rn01_00050589 predicted 1742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029979 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153139 predicted 1846
2 SASI_Mm01_00153140 predicted 583
3 SASI_Mm02_00336313 predicted 1417
4 SASI_Mm01_00153141 predicted 1608
5 SASI_Mm01_00153142 predicted 1821
6 SASI_Mm01_00153143 predicted 1039
7 SASI_Mm01_00153144 predicted 1836
8 SASI_Mm01_00153145 predicted 827
9 SASI_Mm01_00153146 predicted 531
10 SASI_Mm01_00153147 predicted 1616
11 SASI_Mm01_00153148 predicted 1850
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029979
VALIDATED
TRIM35 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 35
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029979.1-902s1c1
Sequence:CCGGCGAGTCTGGAAGAAGATGCTTCTCGAGAAGCATCTTCTTCCAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029979.1-552s1c1
Sequence:CCGGCCAAGCACAATGAGGTGCAAACTCGAGTTTGCACCTCATTGTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029979.1-1551s1c1
Sequence:CCGGCCTGACACATGCAGCATACTACTCGAGTAGTATGCTGCATGTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029979.1-488s1c1
Sequence:CCGGGAGCATGTATTGCGAGAGAAACTCGAGTTTCTCTCGCAATACATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029979.1-657s1c1
Sequence:CCGGCCATGAAGGAAGAGAGCAGAACTCGAGTTCTGCTCTCTTCCTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029979.3-713s21c1
Sequence:CCGGCCATGAAGGAAGAGAGCAGAACTCGAGTTCTGCTCTCTTCCTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029979.3-958s21c1
Sequence:CCGGCGAGTCTGGAAGAAGATGCTTCTCGAGAAGCATCTTCTTCCAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029979.3-1607s21c1
Sequence:CCGGCCTGACACATGCAGCATACTACTCGAGTAGTATGCTGCATGTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029979.3-544s21c1
Sequence:CCGGGAGCATGTATTGCGAGAGAAACTCGAGTTTCTCTCGCAATACATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029979
VALIDATED
TRIM35 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 35
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029979.1-902s1c1
Sequence:CCGGCGAGTCTGGAAGAAGATGCTTCTCGAGAAGCATCTTCTTCCAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029979.1-552s1c1
Sequence:CCGGCCAAGCACAATGAGGTGCAAACTCGAGTTTGCACCTCATTGTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029979.1-1551s1c1
Sequence:CCGGCCTGACACATGCAGCATACTACTCGAGTAGTATGCTGCATGTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029979.1-488s1c1
Sequence:CCGGGAGCATGTATTGCGAGAGAAACTCGAGTTTCTCTCGCAATACATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029979.1-657s1c1
Sequence:CCGGCCATGAAGGAAGAGAGCAGAACTCGAGTTCTGCTCTCTTCCTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029979.3-713s21c1
Sequence:CCGGCCATGAAGGAAGAGAGCAGAACTCGAGTTCTGCTCTCTTCCTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029979.3-958s21c1
Sequence:CCGGCGAGTCTGGAAGAAGATGCTTCTCGAGAAGCATCTTCTTCCAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029979.3-1607s21c1
Sequence:CCGGCCTGACACATGCAGCATACTACTCGAGTAGTATGCTGCATGTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029979.3-544s21c1
Sequence:CCGGGAGCATGTATTGCGAGAGAAACTCGAGTTTCTCTCGCAATACATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029979
VALIDATED
TRIM35 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 35
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029979.1-902s1c1
Sequence:CCGGCGAGTCTGGAAGAAGATGCTTCTCGAGAAGCATCTTCTTCCAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029979.1-552s1c1
Sequence:CCGGCCAAGCACAATGAGGTGCAAACTCGAGTTTGCACCTCATTGTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029979.1-1551s1c1
Sequence:CCGGCCTGACACATGCAGCATACTACTCGAGTAGTATGCTGCATGTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029979.1-488s1c1
Sequence:CCGGGAGCATGTATTGCGAGAGAAACTCGAGTTTCTCTCGCAATACATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029979.1-657s1c1
Sequence:CCGGCCATGAAGGAAGAGAGCAGAACTCGAGTTCTGCTCTCTTCCTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029979.3-713s21c1
Sequence:CCGGCCATGAAGGAAGAGAGCAGAACTCGAGTTCTGCTCTCTTCCTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029979.3-958s21c1
Sequence:CCGGCGAGTCTGGAAGAAGATGCTTCTCGAGAAGCATCTTCTTCCAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029979.3-1607s21c1
Sequence:CCGGCCTGACACATGCAGCATACTACTCGAGTAGTATGCTGCATGTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029979.3-544s21c1
Sequence:CCGGGAGCATGTATTGCGAGAGAAACTCGAGTTTCTCTCGCAATACATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015066
VALIDATED
TRIM35 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 35
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015066.1-841s1c1
Sequence:CCGGCATGAAACACAAGAGCCGAAACTCGAGTTTCGGCTCTTGTGTTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015066.1-352s1c1
Sequence:CCGGGCGCTGGACCAGCTACCGCTTCTCGAGAAGCGGTAGCTGGTCCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_015066.1-968s1c1
Sequence:CCGGCTTGCATCTGTGGAATCTGTACTCGAGTACAGATTCCACAGATGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015066.1-950s1c1
Sequence:CCGGCGCGTCTGGAAGAAGATGCTTCTCGAGAAGCATCTTCTTCCAGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_015066.1-1538s1c1
Sequence:CCGGAGTGTCAAGGAAGAACTGGATCTCGAGATCCAGTTCTTCCTTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015066
VALIDATED
TRIM35 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 35
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015066.1-841s1c1
Sequence:CCGGCATGAAACACAAGAGCCGAAACTCGAGTTTCGGCTCTTGTGTTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015066.1-352s1c1
Sequence:CCGGGCGCTGGACCAGCTACCGCTTCTCGAGAAGCGGTAGCTGGTCCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_015066.1-968s1c1
Sequence:CCGGCTTGCATCTGTGGAATCTGTACTCGAGTACAGATTCCACAGATGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015066.1-950s1c1
Sequence:CCGGCGCGTCTGGAAGAAGATGCTTCTCGAGAAGCATCTTCTTCCAGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_015066.1-1538s1c1
Sequence:CCGGAGTGTCAAGGAAGAACTGGATCTCGAGATCCAGTTCTTCCTTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015066
VALIDATED
TRIM35 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 35
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015066.1-841s1c1
Sequence:CCGGCATGAAACACAAGAGCCGAAACTCGAGTTTCGGCTCTTGTGTTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015066.1-352s1c1
Sequence:CCGGGCGCTGGACCAGCTACCGCTTCTCGAGAAGCGGTAGCTGGTCCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_015066.1-968s1c1
Sequence:CCGGCTTGCATCTGTGGAATCTGTACTCGAGTACAGATTCCACAGATGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015066.1-950s1c1
Sequence:CCGGCGCGTCTGGAAGAAGATGCTTCTCGAGAAGCATCTTCTTCCAGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_015066.1-1538s1c1
Sequence:CCGGAGTGTCAAGGAAGAACTGGATCTCGAGATCCAGTTCTTCCTTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks