EMAIL THIS PAGE TO A FRIEND

TRIM36

tripartite motif containing 36

Synonyms: HAPRIN RBCC728 RNF98
UniProtKB ID: Q9NQ86, A1L3Z1, A6NDD0, Q0P5Z9
Gene ID:
Human(55521) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(28105) tripartite motif-containing 36
Rat(291597) tripartite motif-containing 36
Zebrafish(406849) tripartite motif-containing 36
chicken(426811) tripartite motif containing 36
dog(474639) tripartite motif containing 36
Horse(100064311) tripartite motif containing 36
domestic cat(101089417) tripartite motif containing 36
domestic guinea pig(100735012) tripartite motif containing 36
naked mole-rat(101724705) tripartite motif containing 36
cow(539023) tripartite motif containing 36
sheep(101106080) tripartite motif containing 36
176 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018700 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018700 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018700 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178872 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178872 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178872 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129581 MISSION® esiRNA esiRNA human TRIM36 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017397 Rosetta Predictions human pricing
NM_001017398 Rosetta Predictions human pricing
NM_018700 Rosetta Predictions human pricing
NM_001106147 Rosetta Predictions rat pricing
NM_178872 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225625 predicted 629
2 SASI_Hs01_00225626 predicted 628
3 SASI_Hs01_00225627 predicted 543
4 SASI_Hs01_00225628 predicted 643
5 SASI_Hs02_00306727 predicted 545
6 SASI_Hs01_00225629 predicted 540
7 SASI_Hs01_00225630 predicted 619
8 SASI_Hs01_00225631 predicted 604
9 SASI_Hs01_00225632 predicted 522
10 SASI_Hs02_00306728 predicted 535
11 SASI_Hs01_00225633 predicted 611
12 SASI_Hs01_00225634 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175426 predicted 752
2 SASI_Hs02_00306729 predicted 544
3 SASI_Hs01_00175429 predicted 778
4 SASI_Hs01_00175430 predicted 593
5 SASI_Hs01_00175431 predicted 598
6 SASI_Hs02_00306730 predicted 600
7 SASI_Hs02_00306731 predicted 747
8 SASI_Hs01_00175432 predicted 571
9 SASI_Hs01_00175433 predicted 737
10 SASI_Hs01_00175435 predicted 642
11 SASI_Hs01_00175427 predicted 698
12 SASI_Hs01_00175428 predicted 873
13 SASI_Hs01_00175434 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166748 predicted 1968
2 SASI_Hs01_00166749 predicted 1471
3 SASI_Hs01_00166750 predicted 1558
4 SASI_Hs01_00166752 predicted 1201
5 SASI_Hs01_00166753 predicted 1842
6 SASI_Hs01_00166754 predicted 591
7 SASI_Hs01_00166755 predicted 1376
8 SASI_Hs01_00166756 predicted 2170
9 SASI_Hs02_00352229 predicted 1944
10 SASI_Hs02_00352230 predicted 617
11 SASI_Hs01_00166747 predicted 1989
12 SASI_Hs01_00166751 predicted 1584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216088 predicted 1432
2 SASI_Rn02_00216089 predicted 1974
3 SASI_Rn02_00216090 predicted 1419
4 SASI_Rn02_00216091 predicted 1699
5 SASI_Rn02_00216092 predicted 1598
6 SASI_Rn02_00216093 predicted 2288
7 SASI_Rn02_00216094 predicted 205
8 SASI_Rn02_00216095 predicted 1210
9 SASI_Rn02_00216096 predicted 1313
10 SASI_Rn02_00216097 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178872 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090439 predicted 1127
2 SASI_Mm01_00090440 predicted 1827
3 SASI_Mm01_00090441 predicted 246
4 SASI_Mm01_00090442 predicted 1455
5 SASI_Mm01_00090443 predicted 1555
6 SASI_Mm02_00349455 predicted 855
7 SASI_Mm01_00090444 predicted 2249
8 SASI_Mm01_00090445 predicted 345
9 SASI_Mm01_00090446 predicted 2180
10 SASI_Mm01_00090448 predicted 1517
11 SASI_Mm01_00090447 predicted 2404
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018700
VALIDATED
TRIM36 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 36
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018700.3-636s21c1
Sequence:CCGGCCATTGATTCTCCCTTGCCAACTCGAGTTGGCAAGGGAGAATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018700.3-2287s21c1
Sequence:CCGGCTAGCGATAAACTACAAGAATCTCGAGATTCTTGTAGTTTATCGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018700.3-1806s21c1
Sequence:CCGGGCCTTGATAAATTGGCACCATCTCGAGATGGTGCCAATTTATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018700.3-888s21c1
Sequence:CCGGCGAGGAATCAATGGTCTGTTTCTCGAGAAACAGACCATTGATTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_018700.2-501s1c1
Sequence:CCGGCGAGGAATCAATGGTCTGTTTCTCGAGAAACAGACCATTGATTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018700.2-1419s1c1
Sequence:CCGGGCCTTGATAAATTGGCACCATCTCGAGATGGTGCCAATTTATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018700.2-1743s1c1
Sequence:CCGGGCTGGATTTAATCTTCTGCTTCTCGAGAAGCAGAAGATTAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018700.2-1900s1c1
Sequence:CCGGCTAGCGATAAACTACAAGAATCTCGAGATTCTTGTAGTTTATCGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018700.2-249s1c1
Sequence:CCGGCCATTGATTCTCCCTTGCCAACTCGAGTTGGCAAGGGAGAATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018700
VALIDATED
TRIM36 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 36
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018700.3-636s21c1
Sequence:CCGGCCATTGATTCTCCCTTGCCAACTCGAGTTGGCAAGGGAGAATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018700.3-2287s21c1
Sequence:CCGGCTAGCGATAAACTACAAGAATCTCGAGATTCTTGTAGTTTATCGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018700.3-1806s21c1
Sequence:CCGGGCCTTGATAAATTGGCACCATCTCGAGATGGTGCCAATTTATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018700.3-888s21c1
Sequence:CCGGCGAGGAATCAATGGTCTGTTTCTCGAGAAACAGACCATTGATTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_018700.2-501s1c1
Sequence:CCGGCGAGGAATCAATGGTCTGTTTCTCGAGAAACAGACCATTGATTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018700.2-1419s1c1
Sequence:CCGGGCCTTGATAAATTGGCACCATCTCGAGATGGTGCCAATTTATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018700.2-1743s1c1
Sequence:CCGGGCTGGATTTAATCTTCTGCTTCTCGAGAAGCAGAAGATTAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018700.2-1900s1c1
Sequence:CCGGCTAGCGATAAACTACAAGAATCTCGAGATTCTTGTAGTTTATCGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018700.2-249s1c1
Sequence:CCGGCCATTGATTCTCCCTTGCCAACTCGAGTTGGCAAGGGAGAATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018700
VALIDATED
TRIM36 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 36
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018700.3-636s21c1
Sequence:CCGGCCATTGATTCTCCCTTGCCAACTCGAGTTGGCAAGGGAGAATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018700.3-2287s21c1
Sequence:CCGGCTAGCGATAAACTACAAGAATCTCGAGATTCTTGTAGTTTATCGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018700.3-1806s21c1
Sequence:CCGGGCCTTGATAAATTGGCACCATCTCGAGATGGTGCCAATTTATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018700.3-888s21c1
Sequence:CCGGCGAGGAATCAATGGTCTGTTTCTCGAGAAACAGACCATTGATTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_018700.2-501s1c1
Sequence:CCGGCGAGGAATCAATGGTCTGTTTCTCGAGAAACAGACCATTGATTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018700.2-1419s1c1
Sequence:CCGGGCCTTGATAAATTGGCACCATCTCGAGATGGTGCCAATTTATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018700.2-1743s1c1
Sequence:CCGGGCTGGATTTAATCTTCTGCTTCTCGAGAAGCAGAAGATTAAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018700.2-1900s1c1
Sequence:CCGGCTAGCGATAAACTACAAGAATCTCGAGATTCTTGTAGTTTATCGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018700.2-249s1c1
Sequence:CCGGCCATTGATTCTCCCTTGCCAACTCGAGTTGGCAAGGGAGAATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178872
TRIM36 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 36
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178872.3-1128s1c1
Sequence:CCGGGCCTCTAAGAAACTAAGACTACTCGAGTAGTCTTAGTTTCTTAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178872.3-220s1c1
Sequence:CCGGGCAAGGTGACTATTAAGAATACTCGAGTATTCTTAATAGTCACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178872.3-197s1c1
Sequence:CCGGCATTATGGAATTGCTTGCCAACTCGAGTTGGCAAGCAATTCCATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178872.3-315s1c1
Sequence:CCGGGTCTGTCATAAGTGTGTGAAACTCGAGTTTCACACACTTATGACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173151    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178872.3-2632s1c1
Sequence:CCGGCCTTGTCTCTTCCACGTCATTCTCGAGAATGACGTGGAAGAGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178872
TRIM36 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 36
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178872.3-1128s1c1
Sequence:CCGGGCCTCTAAGAAACTAAGACTACTCGAGTAGTCTTAGTTTCTTAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178872.3-220s1c1
Sequence:CCGGGCAAGGTGACTATTAAGAATACTCGAGTATTCTTAATAGTCACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178872.3-197s1c1
Sequence:CCGGCATTATGGAATTGCTTGCCAACTCGAGTTGGCAAGCAATTCCATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178872.3-315s1c1
Sequence:CCGGGTCTGTCATAAGTGTGTGAAACTCGAGTTTCACACACTTATGACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173151    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178872.3-2632s1c1
Sequence:CCGGCCTTGTCTCTTCCACGTCATTCTCGAGAATGACGTGGAAGAGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178872
TRIM36 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 36
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178872.3-1128s1c1
Sequence:CCGGGCCTCTAAGAAACTAAGACTACTCGAGTAGTCTTAGTTTCTTAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178872.3-220s1c1
Sequence:CCGGGCAAGGTGACTATTAAGAATACTCGAGTATTCTTAATAGTCACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178872.3-197s1c1
Sequence:CCGGCATTATGGAATTGCTTGCCAACTCGAGTTGGCAAGCAATTCCATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178872.3-315s1c1
Sequence:CCGGGTCTGTCATAAGTGTGTGAAACTCGAGTTTCACACACTTATGACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173151    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178872.3-2632s1c1
Sequence:CCGGCCTTGTCTCTTCCACGTCATTCTCGAGAATGACGTGGAAGAGACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks