EMAIL THIS PAGE TO A FRIEND

TRIM37

tripartite motif containing 37

Synonyms: MUL POB1 TEF3
UniProtKB ID: O94972, Q7Z3E6, Q8IYF7, Q8WYF7
Gene ID:
Human(4591) Summary: This gene encodes a member of the tripartite motif (TRIM) family, whose members are involved in diverse cellular functions such as developmental patterning and oncogenesis. The TRIM motif includes zinc-binding domains, a RING finger region, a B-box motif and a coiled-coil domain. The RING finger and B-box domains chelate zinc and might be involved in protein-protein and/or protein-nucleic acid interactions. The gene mutations are associated with mulibrey (muscle-liver-brain-eye) nanism, an autosomal recessive disorder that involves several tissues of mesodermal origin. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
Mouse(68729) tripartite motif-containing 37
Rat(360592) tripartite motif-containing 37
Zebrafish(324237) tripartite motif containing 37
dog(480575) tripartite motif containing 37
Horse(100057121) tripartite motif containing 37
domestic cat(101095387) tripartite motif containing 37
chicken(417628) tripartite motif containing 37
cow(617078) tripartite motif containing 37
sheep(101106605) tripartite motif containing 37
naked mole-rat(101716732) tripartite motif containing 37
Domestic Rabbit(100353301) tripartite motif containing 37
domestic guinea pig(100714025) tripartite motif containing 37
137 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_197987 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_197987 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_197987 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015294 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015294 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015294 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005207 Rosetta Predictions human pricing
NM_015294 Rosetta Predictions human pricing
NM_001108288 Rosetta Predictions rat pricing
NM_197987 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196110 predicted 1853
2 SASI_Hs01_00196111 predicted 2166
3 SASI_Hs01_00196112 predicted 1680
4 SASI_Hs01_00196113 predicted 779
5 SASI_Hs01_00196115 predicted 3048
6 SASI_Hs01_00196116 predicted 960
7 SASI_Hs01_00196117 predicted 2629
8 SASI_Hs01_00196118 predicted 618
9 SASI_Hs01_00196119 predicted 2699
10 SASI_Hs02_00304781 predicted 1813
11 SASI_Hs01_00196114 predicted 1555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106736 predicted 1862
2 SASI_Hs01_00106737 predicted 2169
3 SASI_Hs01_00106738 predicted 1679
4 SASI_Hs01_00106739 predicted 780
5 SASI_Hs01_00106741 predicted 3047
6 SASI_Hs01_00106742 predicted 960
7 SASI_Hs01_00106743 predicted 2627
8 SASI_Hs01_00106744 predicted 620
9 SASI_Hs01_00106745 predicted 2697
10 SASI_Hs02_00347485 predicted 1811
11 SASI_Hs01_00106740 predicted 1556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108288 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237179 predicted 2921
2 SASI_Rn02_00237180 predicted 738
3 SASI_Rn02_00237181 predicted 702
4 SASI_Rn02_00237182 predicted 2106
5 SASI_Rn02_00237183 predicted 3224
6 SASI_Rn02_00237184 predicted 2378
7 SASI_Rn02_00237185 predicted 1476
8 SASI_Rn02_00237186 predicted 1993
9 SASI_Rn02_00237187 predicted 1136
10 SASI_Rn02_00237188 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197987 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137184 predicted 3364
2 SASI_Mm01_00137185 predicted 1743
3 SASI_Mm01_00137186 predicted 2161
4 SASI_Mm01_00137188 predicted 954
5 SASI_Mm02_00350671 predicted 1397
6 SASI_Mm01_00137189 predicted 994
7 SASI_Mm01_00137190 predicted 448
8 SASI_Mm01_00137191 predicted 2604
9 SASI_Mm02_00350672 predicted 1482
10 SASI_Mm01_00137192 predicted 1556
11 SASI_Mm01_00137187 predicted 2233
12 SASI_Mm01_00137193 predicted 2996
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_197987
VALIDATED
TRIM37 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 37
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197987.1-873s1c1
Sequence:CCGGGCTTAGTTCAAGAAGTGGAAACTCGAGTTTCCACTTCTTGAACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197987.1-1642s1c1
Sequence:CCGGGCACTGGTATATTACTCAGTTCTCGAGAACTGAGTAATATACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197987.1-2001s1c1
Sequence:CCGGGCAGCTCTTCTGCTAGTTCTACTCGAGTAGAACTAGCAGAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197987.1-2584s1c1
Sequence:CCGGCTCTGGTAGATTACAGGATTTCTCGAGAAATCCTGTAATCTACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197987.1-714s1c1
Sequence:CCGGGCTGGACTTGTAAGAAGTGTACTCGAGTACACTTCTTACAAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197987.1-3518s21c1
Sequence:CCGGACAGTGTAGTGCTCAATTAATCTCGAGATTAATTGAGCACTACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197987.1-714s21c1
Sequence:CCGGGCTGGACTTGTAAGAAGTGTACTCGAGTACACTTCTTACAAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197987.1-1642s21c1
Sequence:CCGGGCACTGGTATATTACTCAGTTCTCGAGAACTGAGTAATATACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197987.1-873s21c1
Sequence:CCGGGCTTAGTTCAAGAAGTGGAAACTCGAGTTTCCACTTCTTGAACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197987.1-2001s21c1
Sequence:CCGGGCAGCTCTTCTGCTAGTTCTACTCGAGTAGAACTAGCAGAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_197987
VALIDATED
TRIM37 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 37
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197987.1-873s1c1
Sequence:CCGGGCTTAGTTCAAGAAGTGGAAACTCGAGTTTCCACTTCTTGAACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197987.1-1642s1c1
Sequence:CCGGGCACTGGTATATTACTCAGTTCTCGAGAACTGAGTAATATACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197987.1-2001s1c1
Sequence:CCGGGCAGCTCTTCTGCTAGTTCTACTCGAGTAGAACTAGCAGAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197987.1-2584s1c1
Sequence:CCGGCTCTGGTAGATTACAGGATTTCTCGAGAAATCCTGTAATCTACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197987.1-714s1c1
Sequence:CCGGGCTGGACTTGTAAGAAGTGTACTCGAGTACACTTCTTACAAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197987.1-3518s21c1
Sequence:CCGGACAGTGTAGTGCTCAATTAATCTCGAGATTAATTGAGCACTACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197987.1-714s21c1
Sequence:CCGGGCTGGACTTGTAAGAAGTGTACTCGAGTACACTTCTTACAAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197987.1-1642s21c1
Sequence:CCGGGCACTGGTATATTACTCAGTTCTCGAGAACTGAGTAATATACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197987.1-873s21c1
Sequence:CCGGGCTTAGTTCAAGAAGTGGAAACTCGAGTTTCCACTTCTTGAACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197987.1-2001s21c1
Sequence:CCGGGCAGCTCTTCTGCTAGTTCTACTCGAGTAGAACTAGCAGAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_197987
VALIDATED
TRIM37 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 37
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197987.1-873s1c1
Sequence:CCGGGCTTAGTTCAAGAAGTGGAAACTCGAGTTTCCACTTCTTGAACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197987.1-1642s1c1
Sequence:CCGGGCACTGGTATATTACTCAGTTCTCGAGAACTGAGTAATATACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197987.1-2001s1c1
Sequence:CCGGGCAGCTCTTCTGCTAGTTCTACTCGAGTAGAACTAGCAGAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197987.1-2584s1c1
Sequence:CCGGCTCTGGTAGATTACAGGATTTCTCGAGAAATCCTGTAATCTACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_197987.1-714s1c1
Sequence:CCGGGCTGGACTTGTAAGAAGTGTACTCGAGTACACTTCTTACAAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197987.1-3518s21c1
Sequence:CCGGACAGTGTAGTGCTCAATTAATCTCGAGATTAATTGAGCACTACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197987.1-714s21c1
Sequence:CCGGGCTGGACTTGTAAGAAGTGTACTCGAGTACACTTCTTACAAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197987.1-1642s21c1
Sequence:CCGGGCACTGGTATATTACTCAGTTCTCGAGAACTGAGTAATATACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197987.1-873s21c1
Sequence:CCGGGCTTAGTTCAAGAAGTGGAAACTCGAGTTTCCACTTCTTGAACTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197987.1-2001s21c1
Sequence:CCGGGCAGCTCTTCTGCTAGTTCTACTCGAGTAGAACTAGCAGAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015294
VALIDATED
TRIM37 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 37
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_015294.1-838s1c1
Sequence:CCGGCCACCAGACTTTACCAGTGAACTCGAGTTCACTGGTAAAGTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015294.1-1182s1c1
Sequence:CCGGCCGTTTGGACTTACTCGCAAACTCGAGTTTGCGAGTAAGTCCAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015294.1-1988s1c1
Sequence:CCGGCCACAGCATCATATTCTCGAACTCGAGTTCGAGAATATGATGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015294.1-2623s1c1
Sequence:CCGGGCTAATGCTAAAGGAGGTCATCTCGAGATGACCTCCTTTAGCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015294.1-2342s1c1
Sequence:CCGGCCAGTGTAGCAGGTAGTCTATCTCGAGATAGACTACCTGCTACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015294.3-1400s21c1
Sequence:CCGGTTGTGCGAGGTTACTACTTATCTCGAGATAAGTAGTAACCTCGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015294.3-1356s21c1
Sequence:CCGGAGGACTTTGCTGGAGGTTAAACTCGAGTTTAACCTCCAGCAAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015294.3-2277s21c1
Sequence:CCGGACTAGACATTGATCCATTAATCTCGAGATTAATGGATCAATGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015294.3-3454s21c1
Sequence:CCGGCTCGACCTGAAATAGTAATTTCTCGAGAAATTACTATTTCAGGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015294.3-850s21c1
Sequence:CCGGTATGAGCAACACGTCACTAAACTCGAGTTTAGTGACGTGTTGCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015294.3-2886s21c1
Sequence:CCGGACATGGCAGTATCGGTGATATCTCGAGATATCACCGATACTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015294
VALIDATED
TRIM37 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 37
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_015294.1-838s1c1
Sequence:CCGGCCACCAGACTTTACCAGTGAACTCGAGTTCACTGGTAAAGTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015294.1-1182s1c1
Sequence:CCGGCCGTTTGGACTTACTCGCAAACTCGAGTTTGCGAGTAAGTCCAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015294.1-1988s1c1
Sequence:CCGGCCACAGCATCATATTCTCGAACTCGAGTTCGAGAATATGATGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015294.1-2623s1c1
Sequence:CCGGGCTAATGCTAAAGGAGGTCATCTCGAGATGACCTCCTTTAGCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015294.1-2342s1c1
Sequence:CCGGCCAGTGTAGCAGGTAGTCTATCTCGAGATAGACTACCTGCTACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015294.3-1400s21c1
Sequence:CCGGTTGTGCGAGGTTACTACTTATCTCGAGATAAGTAGTAACCTCGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015294.3-1356s21c1
Sequence:CCGGAGGACTTTGCTGGAGGTTAAACTCGAGTTTAACCTCCAGCAAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015294.3-2277s21c1
Sequence:CCGGACTAGACATTGATCCATTAATCTCGAGATTAATGGATCAATGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015294.3-3454s21c1
Sequence:CCGGCTCGACCTGAAATAGTAATTTCTCGAGAAATTACTATTTCAGGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015294.3-850s21c1
Sequence:CCGGTATGAGCAACACGTCACTAAACTCGAGTTTAGTGACGTGTTGCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015294.3-2886s21c1
Sequence:CCGGACATGGCAGTATCGGTGATATCTCGAGATATCACCGATACTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015294
VALIDATED
TRIM37 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 37
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_015294.1-838s1c1
Sequence:CCGGCCACCAGACTTTACCAGTGAACTCGAGTTCACTGGTAAAGTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015294.1-1182s1c1
Sequence:CCGGCCGTTTGGACTTACTCGCAAACTCGAGTTTGCGAGTAAGTCCAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015294.1-1988s1c1
Sequence:CCGGCCACAGCATCATATTCTCGAACTCGAGTTCGAGAATATGATGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015294.1-2623s1c1
Sequence:CCGGGCTAATGCTAAAGGAGGTCATCTCGAGATGACCTCCTTTAGCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015294.1-2342s1c1
Sequence:CCGGCCAGTGTAGCAGGTAGTCTATCTCGAGATAGACTACCTGCTACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015294.3-1400s21c1
Sequence:CCGGTTGTGCGAGGTTACTACTTATCTCGAGATAAGTAGTAACCTCGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015294.3-1356s21c1
Sequence:CCGGAGGACTTTGCTGGAGGTTAAACTCGAGTTTAACCTCCAGCAAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015294.3-2277s21c1
Sequence:CCGGACTAGACATTGATCCATTAATCTCGAGATTAATGGATCAATGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015294.3-3454s21c1
Sequence:CCGGCTCGACCTGAAATAGTAATTTCTCGAGAAATTACTATTTCAGGTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015294.3-850s21c1
Sequence:CCGGTATGAGCAACACGTCACTAAACTCGAGTTTAGTGACGTGTTGCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015294.3-2886s21c1
Sequence:CCGGACATGGCAGTATCGGTGATATCTCGAGATATCACCGATACTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks