EMAIL THIS PAGE TO A FRIEND

TRIM38

tripartite motif containing 38

Synonyms: RNF15 RORET
UniProtKB ID: O00635
Gene ID:
Human(10475) Summary: This gene encodes a member of the tripartite motif (TRIM) family. The encoded protein contains a RING-type zinc finger, B box-type zinc finger and SPRY domain. The function of this protein has not been identified. A pseudogene of this gene is located on the long arm of chromosome 4. [provided by RefSeq, Jul 2012]
Mouse(214158) tripartite motif-containing 38
domestic guinea pig(100727489) tripartite motif containing 38
Domestic Rabbit(100350255) tripartite motif containing 38
naked mole-rat(101710920) tripartite motif containing 38
cow(531022) tripartite motif containing 38
sheep(101114398) tripartite motif containing 38
Goat(100860991) tripartite motif containing 38
dog(488257) tripartite motif containing 38
domestic cat(101085464) tripartite motif containing 38
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006355 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006355 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006355 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001029935 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001029935 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001029935 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006355 Rosetta Predictions human pricing
NM_001029935 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037044 predicted 1284
2 SASI_Hs01_00037045 predicted 548
3 SASI_Hs01_00037047 predicted 1246
4 SASI_Hs02_00341399 predicted 1406
5 SASI_Hs02_00341400 predicted 1101
6 SASI_Hs02_00341401 predicted 492
7 SASI_Hs01_00037049 predicted 972
8 SASI_Hs01_00037050 predicted 1361
9 SASI_Hs01_00037051 predicted 681
10 SASI_Hs01_00037052 predicted 1244
11 SASI_Hs01_00037046 predicted 1607
12 SASI_Hs01_00037048 predicted 1055
13 SASI_Hs01_00037053 predicted 1468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029935 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170446 predicted 246
2 SASI_Mm01_00170447 predicted 468
3 SASI_Mm01_00170448 predicted 650
4 SASI_Mm01_00170449 predicted 1081
5 SASI_Mm01_00170450 predicted 935
6 SASI_Mm01_00170451 predicted 545
7 SASI_Mm01_00170452 predicted 365
8 SASI_Mm01_00170453 predicted 649
9 SASI_Mm01_00170454 predicted 932
10 SASI_Mm01_00170455 predicted 530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006355
TRIM38 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 38
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006355.2-1779s21c1
Sequence:CCGGCTATTTCCAGGTTTATCAATACTCGAGTATTGATAAACCTGGAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006355.2-1293s21c1
Sequence:CCGGGTTAAGGAGTCATCAAGTTAGCTCGAGCTAACTTGATGACTCCTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006355.2-1061s21c1
Sequence:CCGGTGAGTAGACTGAGGGACTATGCTCGAGCATAGTCCCTCAGTCTACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006355.2-2069s21c1
Sequence:CCGGTGCTGTCTCCATCCGTCTTTACTCGAGTAAAGACGGATGGAGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006355.2-1988s21c1
Sequence:CCGGTATATGGACTTAGCAACTAAACTCGAGTTTAGTTGCTAAGTCCATATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006355.2-2221s21c1
Sequence:CCGGTATCCGCCAACTGCATTTAAACTCGAGTTTAAATGCAGTTGGCGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006355.2-2350s1c1
Sequence:CCGGCCTGAGAAACAGCCAAGCAAACTCGAGTTTGCTTGGCTGTTTCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006355.2-1731s1c1
Sequence:CCGGCCACATCTTTACTTTCCCGAACTCGAGTTCGGGAAAGTAAAGATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006355.2-682s1c1
Sequence:CCGGGCCCTCAAAGAGACGGATCAACTCGAGTTGATCCGTCTCTTTGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006355.2-1095s1c1
Sequence:CCGGGCTGAAGAGCAATGAACTCAACTCGAGTTGAGTTCATTGCTCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006355.2-1505s1c1
Sequence:CCGGCCGGATGGGATTTAGGAGTTTCTCGAGAAACTCCTAAATCCCATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006355
TRIM38 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 38
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006355.2-1779s21c1
Sequence:CCGGCTATTTCCAGGTTTATCAATACTCGAGTATTGATAAACCTGGAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006355.2-1293s21c1
Sequence:CCGGGTTAAGGAGTCATCAAGTTAGCTCGAGCTAACTTGATGACTCCTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006355.2-1061s21c1
Sequence:CCGGTGAGTAGACTGAGGGACTATGCTCGAGCATAGTCCCTCAGTCTACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006355.2-2069s21c1
Sequence:CCGGTGCTGTCTCCATCCGTCTTTACTCGAGTAAAGACGGATGGAGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006355.2-1988s21c1
Sequence:CCGGTATATGGACTTAGCAACTAAACTCGAGTTTAGTTGCTAAGTCCATATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006355.2-2221s21c1
Sequence:CCGGTATCCGCCAACTGCATTTAAACTCGAGTTTAAATGCAGTTGGCGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006355.2-2350s1c1
Sequence:CCGGCCTGAGAAACAGCCAAGCAAACTCGAGTTTGCTTGGCTGTTTCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006355.2-1731s1c1
Sequence:CCGGCCACATCTTTACTTTCCCGAACTCGAGTTCGGGAAAGTAAAGATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006355.2-682s1c1
Sequence:CCGGGCCCTCAAAGAGACGGATCAACTCGAGTTGATCCGTCTCTTTGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006355.2-1095s1c1
Sequence:CCGGGCTGAAGAGCAATGAACTCAACTCGAGTTGAGTTCATTGCTCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006355.2-1505s1c1
Sequence:CCGGCCGGATGGGATTTAGGAGTTTCTCGAGAAACTCCTAAATCCCATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006355
TRIM38 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 38
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006355.2-1779s21c1
Sequence:CCGGCTATTTCCAGGTTTATCAATACTCGAGTATTGATAAACCTGGAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006355.2-1293s21c1
Sequence:CCGGGTTAAGGAGTCATCAAGTTAGCTCGAGCTAACTTGATGACTCCTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006355.2-1061s21c1
Sequence:CCGGTGAGTAGACTGAGGGACTATGCTCGAGCATAGTCCCTCAGTCTACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006355.2-2069s21c1
Sequence:CCGGTGCTGTCTCCATCCGTCTTTACTCGAGTAAAGACGGATGGAGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006355.2-1988s21c1
Sequence:CCGGTATATGGACTTAGCAACTAAACTCGAGTTTAGTTGCTAAGTCCATATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006355.2-2221s21c1
Sequence:CCGGTATCCGCCAACTGCATTTAAACTCGAGTTTAAATGCAGTTGGCGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006355.2-2350s1c1
Sequence:CCGGCCTGAGAAACAGCCAAGCAAACTCGAGTTTGCTTGGCTGTTTCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006355.2-1731s1c1
Sequence:CCGGCCACATCTTTACTTTCCCGAACTCGAGTTCGGGAAAGTAAAGATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006355.2-682s1c1
Sequence:CCGGGCCCTCAAAGAGACGGATCAACTCGAGTTGATCCGTCTCTTTGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006355.2-1095s1c1
Sequence:CCGGGCTGAAGAGCAATGAACTCAACTCGAGTTGAGTTCATTGCTCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006355.2-1505s1c1
Sequence:CCGGCCGGATGGGATTTAGGAGTTTCTCGAGAAACTCCTAAATCCCATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029935
TRIM38 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 38
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029935.1-655s1c1
Sequence:CCGGGCCAATCTACAGCAGACGTTTCTCGAGAAACGTCTGCTGTAGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029935.1-295s1c1
Sequence:CCGGGAAGAGAAGTTCAATCGCTTTCTCGAGAAAGCGATTGAACTTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029935.1-1067s1c1
Sequence:CCGGCTGTTGAGAATGCAACCAGTTCTCGAGAACTGGTTGCATTCTCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029935.1-113s1c1
Sequence:CCGGCCTGCATACAGAGCTATTATTCTCGAGAATAATAGCTCTGTATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029935.1-806s1c1
Sequence:CCGGCCCTGAAGGTTCACACTAAATCTCGAGATTTAGTGTGAACCTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029935
TRIM38 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 38
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029935.1-655s1c1
Sequence:CCGGGCCAATCTACAGCAGACGTTTCTCGAGAAACGTCTGCTGTAGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029935.1-295s1c1
Sequence:CCGGGAAGAGAAGTTCAATCGCTTTCTCGAGAAAGCGATTGAACTTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029935.1-1067s1c1
Sequence:CCGGCTGTTGAGAATGCAACCAGTTCTCGAGAACTGGTTGCATTCTCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029935.1-113s1c1
Sequence:CCGGCCTGCATACAGAGCTATTATTCTCGAGAATAATAGCTCTGTATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029935.1-806s1c1
Sequence:CCGGCCCTGAAGGTTCACACTAAATCTCGAGATTTAGTGTGAACCTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029935
TRIM38 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 38
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029935.1-655s1c1
Sequence:CCGGGCCAATCTACAGCAGACGTTTCTCGAGAAACGTCTGCTGTAGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029935.1-295s1c1
Sequence:CCGGGAAGAGAAGTTCAATCGCTTTCTCGAGAAAGCGATTGAACTTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029935.1-1067s1c1
Sequence:CCGGCTGTTGAGAATGCAACCAGTTCTCGAGAACTGGTTGCATTCTCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029935.1-113s1c1
Sequence:CCGGCCTGCATACAGAGCTATTATTCTCGAGAATAATAGCTCTGTATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029935.1-806s1c1
Sequence:CCGGCCCTGAAGGTTCACACTAAATCTCGAGATTTAGTGTGAACCTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks