EMAIL THIS PAGE TO A FRIEND

TRIM39

tripartite motif containing 39

Synonyms: RNF23 TFP TRIM39B
UniProtKB ID: Q9HCM9, Q5STG3, Q5STG4, Q76BL3, Q8IYT9, Q96IB6
Gene ID:
Human(56658) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The function of this protein has not been identified. This gene lies within the major histocompatibility complex class I region on chromosome 6. Alternate splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(79263) tripartite motif-containing 39
Rat(309591) tripartite motif-containing 39
chicken(417041) tripartite motif containing 39
dog(481703) tripartite motif containing 39
cow(615278) tripartite motif containing 39
Domestic Rabbit(100355869) tripartite motif containing 39
134 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024468 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024468 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024468 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021253 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021253 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021253 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU046851 MISSION® esiRNA esiRNA targeting mouse Trim39 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021253 Rosetta Predictions human pricing
NM_172016 Rosetta Predictions human pricing
NM_213562 Rosetta Predictions rat pricing
NM_024468 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205481 predicted 2339
2 SASI_Hs01_00205482 predicted 964
3 SASI_Hs01_00205483 predicted 2630
4 SASI_Hs01_00205484 predicted 695
5 SASI_Hs01_00205486 predicted 2097
6 SASI_Hs01_00205487 predicted 2583
7 SASI_Hs01_00205488 predicted 1088
8 SASI_Hs02_00354910 predicted 2548
9 SASI_Hs01_00205490 predicted 648
10 SASI_Hs02_00354911 predicted 1174
11 SASI_Hs01_00205485 predicted 2620
12 SASI_Hs01_00205489 predicted 1941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172016 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039301 predicted 2249
2 SASI_Hs01_00039302 predicted 961
3 SASI_Hs01_00039303 predicted 2532
4 SASI_Hs01_00039304 predicted 697
5 SASI_Hs01_00039306 predicted 2010
6 SASI_Hs01_00039307 predicted 2487
7 SASI_Hs01_00039308 predicted 1086
8 SASI_Hs02_00367775 predicted 2464
9 SASI_Hs01_00039310 predicted 643
10 SASI_Hs02_00367776 predicted 1173
11 SASI_Hs01_00039305 predicted 2530
12 SASI_Hs01_00039309 predicted 1850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213562 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094501 predicted 1365
2 SASI_Rn01_00094502 predicted 1469
3 SASI_Rn01_00094503 predicted 1673
4 SASI_Rn01_00094504 predicted 243
5 SASI_Rn01_00094505 predicted 1021
6 SASI_Rn01_00094506 predicted 1528
7 SASI_Rn01_00094509 predicted 1635
8 SASI_Rn01_00094510 predicted 1576
9 SASI_Rn02_00270589 predicted 1674
10 SASI_Rn02_00270590 predicted 249
11 SASI_Rn01_00094507 predicted 1368
12 SASI_Rn01_00094508 predicted 893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024468 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327841 predicted 1025
2 SASI_Mm02_00327842 predicted 756
3 SASI_Mm02_00327843 predicted 244
4 SASI_Mm02_00327844 predicted 1626
5 SASI_Mm02_00327845 predicted 1670
6 SASI_Mm02_00327846 predicted 218
7 SASI_Mm02_00327847 predicted 1581
8 SASI_Mm02_00327848 predicted 487
9 SASI_Mm02_00327849 predicted 1532
10 SASI_Mm02_00327850 predicted 994
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024468
VALIDATED
TRIM39 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 39
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024468.1-2909s1c1
Sequence:CCGGGCCTGGGTAATCTTCACACAACTCGAGTTGTGTGAAGATTACCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024468.1-1100s1c1
Sequence:CCGGGCGTCAAGTTTGTGGAGACAACTCGAGTTGTCTCCACAAACTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024468.1-1455s1c1
Sequence:CCGGCCGTTCACATATCTACACCTTCTCGAGAAGGTGTAGATATGTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024468.1-775s1c1
Sequence:CCGGCAGGACATTCTACAGCGACTTCTCGAGAAGTCGCTGTAGAATGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024468.1-366s1c1
Sequence:CCGGGCTAGGCAGTATGGTGGAAATCTCGAGATTTCCACCATACTGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024468.2-1636s21c1
Sequence:CCGGCCTAACTGGCCTGCTAGAATACTCGAGTATTCTAGCAGGCCAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024468.2-1995s21c1
Sequence:CCGGGTATACCTCGGTGTCGGAAAGCTCGAGCTTTCCGACACCGAGGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024468
VALIDATED
TRIM39 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 39
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024468.1-2909s1c1
Sequence:CCGGGCCTGGGTAATCTTCACACAACTCGAGTTGTGTGAAGATTACCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024468.1-1100s1c1
Sequence:CCGGGCGTCAAGTTTGTGGAGACAACTCGAGTTGTCTCCACAAACTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024468.1-1455s1c1
Sequence:CCGGCCGTTCACATATCTACACCTTCTCGAGAAGGTGTAGATATGTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024468.1-775s1c1
Sequence:CCGGCAGGACATTCTACAGCGACTTCTCGAGAAGTCGCTGTAGAATGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024468.1-366s1c1
Sequence:CCGGGCTAGGCAGTATGGTGGAAATCTCGAGATTTCCACCATACTGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024468.2-1636s21c1
Sequence:CCGGCCTAACTGGCCTGCTAGAATACTCGAGTATTCTAGCAGGCCAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024468.2-1995s21c1
Sequence:CCGGGTATACCTCGGTGTCGGAAAGCTCGAGCTTTCCGACACCGAGGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024468
VALIDATED
TRIM39 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 39
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024468.1-2909s1c1
Sequence:CCGGGCCTGGGTAATCTTCACACAACTCGAGTTGTGTGAAGATTACCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024468.1-1100s1c1
Sequence:CCGGGCGTCAAGTTTGTGGAGACAACTCGAGTTGTCTCCACAAACTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024468.1-1455s1c1
Sequence:CCGGCCGTTCACATATCTACACCTTCTCGAGAAGGTGTAGATATGTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024468.1-775s1c1
Sequence:CCGGCAGGACATTCTACAGCGACTTCTCGAGAAGTCGCTGTAGAATGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024468.1-366s1c1
Sequence:CCGGGCTAGGCAGTATGGTGGAAATCTCGAGATTTCCACCATACTGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024468.2-1636s21c1
Sequence:CCGGCCTAACTGGCCTGCTAGAATACTCGAGTATTCTAGCAGGCCAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024468.2-1995s21c1
Sequence:CCGGGTATACCTCGGTGTCGGAAAGCTCGAGCTTTCCGACACCGAGGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021253
VALIDATED
TRIM39 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 39
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021253.2-2021s1c1
Sequence:CCGGCCGCTCTCATATCTACACCTTCTCGAGAAGGTGTAGATATGAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021253.2-1025s1c1
Sequence:CCGGCGATGCTACACAGGAGTACAACTCGAGTTGTACTCCTGTGTAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021253.2-1361s1c1
Sequence:CCGGCGAGATGCTTAAGGATGTCAACTCGAGTTGACATCCTTAAGCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021253.2-3170s21c1
Sequence:CCGGGGTGGAAGAGGGTGGTATATACTCGAGTATATACCACCCTCTTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021253.2-1955s21c1
Sequence:CCGGACCCAAGCGGGTAGGCATATTCTCGAGAATATGCCTACCCGCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_021253.2-816s21c1
Sequence:CCGGTACCGCAGTCTCCGACCTAATCTCGAGATTAGGTCGGAGACTGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_021253.2-643s21c1
Sequence:CCGGCTGCGGCTTTGGAGAACTTACCTCGAGGTAAGTTCTCCAAAGCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021253.2-1433s21c1
Sequence:CCGGGATCTGTCCACGGGATCATAACTCGAGTTATGATCCCGTGGACAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_021253.3-685s21c1
Sequence:CCGGGTATGCTTGATATGTGCAATTCTCGAGAATTGCACATATCAAGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021253.3-2340s21c1
Sequence:CCGGTGCTCTCATGGGTCTAGATATCTCGAGATATCTAGACCCATGAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_021253.3-1821s21c1
Sequence:CCGGGAAGAATGCTGCACCACTTACCTCGAGGTAAGTGGTGCAGCATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021253
VALIDATED
TRIM39 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 39
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021253.2-2021s1c1
Sequence:CCGGCCGCTCTCATATCTACACCTTCTCGAGAAGGTGTAGATATGAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021253.2-1025s1c1
Sequence:CCGGCGATGCTACACAGGAGTACAACTCGAGTTGTACTCCTGTGTAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021253.2-1361s1c1
Sequence:CCGGCGAGATGCTTAAGGATGTCAACTCGAGTTGACATCCTTAAGCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021253.2-3170s21c1
Sequence:CCGGGGTGGAAGAGGGTGGTATATACTCGAGTATATACCACCCTCTTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021253.2-1955s21c1
Sequence:CCGGACCCAAGCGGGTAGGCATATTCTCGAGAATATGCCTACCCGCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_021253.2-816s21c1
Sequence:CCGGTACCGCAGTCTCCGACCTAATCTCGAGATTAGGTCGGAGACTGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_021253.2-643s21c1
Sequence:CCGGCTGCGGCTTTGGAGAACTTACCTCGAGGTAAGTTCTCCAAAGCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021253.2-1433s21c1
Sequence:CCGGGATCTGTCCACGGGATCATAACTCGAGTTATGATCCCGTGGACAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_021253.3-685s21c1
Sequence:CCGGGTATGCTTGATATGTGCAATTCTCGAGAATTGCACATATCAAGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021253.3-2340s21c1
Sequence:CCGGTGCTCTCATGGGTCTAGATATCTCGAGATATCTAGACCCATGAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_021253.3-1821s21c1
Sequence:CCGGGAAGAATGCTGCACCACTTACCTCGAGGTAAGTGGTGCAGCATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021253
VALIDATED
TRIM39 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 39
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021253.2-2021s1c1
Sequence:CCGGCCGCTCTCATATCTACACCTTCTCGAGAAGGTGTAGATATGAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021253.2-1025s1c1
Sequence:CCGGCGATGCTACACAGGAGTACAACTCGAGTTGTACTCCTGTGTAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021253.2-1361s1c1
Sequence:CCGGCGAGATGCTTAAGGATGTCAACTCGAGTTGACATCCTTAAGCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021253.2-3170s21c1
Sequence:CCGGGGTGGAAGAGGGTGGTATATACTCGAGTATATACCACCCTCTTCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021253.2-1955s21c1
Sequence:CCGGACCCAAGCGGGTAGGCATATTCTCGAGAATATGCCTACCCGCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_021253.2-816s21c1
Sequence:CCGGTACCGCAGTCTCCGACCTAATCTCGAGATTAGGTCGGAGACTGCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_021253.2-643s21c1
Sequence:CCGGCTGCGGCTTTGGAGAACTTACCTCGAGGTAAGTTCTCCAAAGCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021253.2-1433s21c1
Sequence:CCGGGATCTGTCCACGGGATCATAACTCGAGTTATGATCCCGTGGACAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_021253.3-685s21c1
Sequence:CCGGGTATGCTTGATATGTGCAATTCTCGAGAATTGCACATATCAAGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021253.3-2340s21c1
Sequence:CCGGTGCTCTCATGGGTCTAGATATCTCGAGATATCTAGACCCATGAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_021253.3-1821s21c1
Sequence:CCGGGAAGAATGCTGCACCACTTACCTCGAGGTAAGTGGTGCAGCATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks