EMAIL THIS PAGE TO A FRIEND

TRIM3

tripartite motif containing 3

Synonyms: BERP HAC1 RNF22 RNF97
UniProtKB ID: O75382, B7Z5E6, F5H2Q8, Q4V9L4, Q9C038, Q9C039
Gene ID:
Human(10612) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family, also called the 'RING-B-box-coiled-coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to cytoplasmic filaments. It is similar to a rat protein which is a specific partner for the tail domain of myosin V, a class of myosins which are involved in the targeted transport of organelles. The rat protein can also interact with alpha-actinin-4. Thus it is suggested that this human protein may play a role in myosin V-mediated cargo transport. Alternatively spliced transcript variants encoding the same isoform have been identified. [provided by RefSeq, Jul 2008]
Mouse(55992) tripartite motif-containing 3
Rat(83616) tripartite motif-containing 3
chicken(425131) tripartite motif-containing 3
domestic cat(101091398) tripartite motif containing 3
Horse(100055164) tripartite motif containing 3
dog(476834) tripartite motif containing 3
cow(534510) tripartite motif containing 3
sheep(101117614) tripartite motif containing 3
domestic guinea pig(100734787) tripartite motif containing 3
naked mole-rat(101702043) tripartite motif containing 3
144 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006458 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006458 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006458 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018880 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018880 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018880 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006458 Rosetta Predictions human pricing
NM_033278 Rosetta Predictions human pricing
NM_031786 Rosetta Predictions rat pricing
NM_018880 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102700 predicted 1765
2 SASI_Hs01_00102701 predicted 1895
3 SASI_Hs01_00102702 predicted 2288
4 SASI_Hs01_00102703 predicted 1529
5 SASI_Hs01_00102704 predicted 2005
6 SASI_Hs01_00102705 predicted 2341
7 SASI_Hs01_00102706 predicted 2144
8 SASI_Hs01_00102707 predicted 2586
9 SASI_Hs01_00102708 predicted 2018
10 SASI_Hs01_00102709 predicted 1832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230381 predicted 1604
2 SASI_Hs01_00230382 predicted 1735
3 SASI_Hs01_00230383 predicted 2128
4 SASI_Hs01_00230384 predicted 1363
5 SASI_Hs01_00230385 predicted 1842
6 SASI_Hs01_00230386 predicted 2173
7 SASI_Hs01_00230387 predicted 1974
8 SASI_Hs01_00230388 predicted 2427
9 SASI_Hs01_00230389 predicted 1850
10 SASI_Hs01_00230390 predicted 1671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031786 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070577 predicted 2119
2 SASI_Rn01_00070578 predicted 281
3 SASI_Rn01_00070579 predicted 2420
4 SASI_Rn01_00070580 predicted 1845
5 SASI_Rn01_00070581 predicted 814
6 SASI_Rn01_00070582 predicted 1756
7 SASI_Rn01_00070583 predicted 306
8 SASI_Rn01_00070584 predicted 1979
9 SASI_Rn01_00070585 predicted 1705
10 SASI_Rn02_00265226 predicted 1993
11 SASI_Rn01_00070586 predicted 1669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324285 predicted 1760
2 SASI_Mm01_00091554 predicted 220
3 SASI_Mm01_00091555 predicted 2333
4 SASI_Mm01_00091556 predicted 1753
5 SASI_Mm01_00091557 predicted 1879
6 SASI_Mm01_00091558 predicted 1669
7 SASI_Mm01_00091559 predicted 1280
8 SASI_Mm01_00091560 predicted 1894
9 SASI_Mm01_00091561 predicted 1517
10 SASI_Mm01_00091562 predicted 1538
11 SASI_Mm01_00091563 predicted 245
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006458
VALIDATED
TRIM3 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006458.2-2774s1c1
Sequence:CCGGCCACGGTTGCACTTTATTTATCTCGAGATAAATAAAGTGCAACCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006458.2-2272s1c1
Sequence:CCGGGCTGTGAACAACAAGAATGAACTCGAGTTCATTCTTGTTGTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006458.2-1525s1c1
Sequence:CCGGGACCACAAGAATGGCACATATCTCGAGATATGTGCCATTCTTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006458.2-1072s1c1
Sequence:CCGGGCCAAACAGAAGGTGTTGCAACTCGAGTTGCAACACCTTCTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_006458.2-2023s1c1
Sequence:CCGGGACATAATTGTGGCAGACTATCTCGAGATAGTCTGCCACAATTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006458.2-1525s21c1
Sequence:CCGGGACCACAAGAATGGCACATATCTCGAGATATGTGCCATTCTTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006458.2-2272s21c1
Sequence:CCGGGCTGTGAACAACAAGAATGAACTCGAGTTCATTCTTGTTGTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006458.2-552s21c1
Sequence:CCGGGACGCTATCCTGTCCAGTATGCTCGAGCATACTGGACAGGATAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006458.2-2168s21c1
Sequence:CCGGACAAGTCTTGCTGCGTCTTTACTCGAGTAAAGACGCAGCAAGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006458.2-2854s21c1
Sequence:CCGGGCTTCACCCTACCCTTCTTACCTCGAGGTAAGAAGGGTAGGGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006458
VALIDATED
TRIM3 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006458.2-2774s1c1
Sequence:CCGGCCACGGTTGCACTTTATTTATCTCGAGATAAATAAAGTGCAACCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006458.2-2272s1c1
Sequence:CCGGGCTGTGAACAACAAGAATGAACTCGAGTTCATTCTTGTTGTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006458.2-1525s1c1
Sequence:CCGGGACCACAAGAATGGCACATATCTCGAGATATGTGCCATTCTTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006458.2-1072s1c1
Sequence:CCGGGCCAAACAGAAGGTGTTGCAACTCGAGTTGCAACACCTTCTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_006458.2-2023s1c1
Sequence:CCGGGACATAATTGTGGCAGACTATCTCGAGATAGTCTGCCACAATTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006458.2-1525s21c1
Sequence:CCGGGACCACAAGAATGGCACATATCTCGAGATATGTGCCATTCTTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006458.2-2272s21c1
Sequence:CCGGGCTGTGAACAACAAGAATGAACTCGAGTTCATTCTTGTTGTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006458.2-552s21c1
Sequence:CCGGGACGCTATCCTGTCCAGTATGCTCGAGCATACTGGACAGGATAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006458.2-2168s21c1
Sequence:CCGGACAAGTCTTGCTGCGTCTTTACTCGAGTAAAGACGCAGCAAGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006458.2-2854s21c1
Sequence:CCGGGCTTCACCCTACCCTTCTTACCTCGAGGTAAGAAGGGTAGGGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006458
VALIDATED
TRIM3 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006458.2-2774s1c1
Sequence:CCGGCCACGGTTGCACTTTATTTATCTCGAGATAAATAAAGTGCAACCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006458.2-2272s1c1
Sequence:CCGGGCTGTGAACAACAAGAATGAACTCGAGTTCATTCTTGTTGTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006458.2-1525s1c1
Sequence:CCGGGACCACAAGAATGGCACATATCTCGAGATATGTGCCATTCTTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006458.2-1072s1c1
Sequence:CCGGGCCAAACAGAAGGTGTTGCAACTCGAGTTGCAACACCTTCTGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_006458.2-2023s1c1
Sequence:CCGGGACATAATTGTGGCAGACTATCTCGAGATAGTCTGCCACAATTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006458.2-1525s21c1
Sequence:CCGGGACCACAAGAATGGCACATATCTCGAGATATGTGCCATTCTTGTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006458.2-2272s21c1
Sequence:CCGGGCTGTGAACAACAAGAATGAACTCGAGTTCATTCTTGTTGTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006458.2-552s21c1
Sequence:CCGGGACGCTATCCTGTCCAGTATGCTCGAGCATACTGGACAGGATAGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006458.2-2168s21c1
Sequence:CCGGACAAGTCTTGCTGCGTCTTTACTCGAGTAAAGACGCAGCAAGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006458.2-2854s21c1
Sequence:CCGGGCTTCACCCTACCCTTCTTACCTCGAGGTAAGAAGGGTAGGGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018880
VALIDATED
TRIM3 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018880.1-2549s1c1
Sequence:CCGGCCCACGGTTGCACTTTATTTACTCGAGTAAATAAAGTGCAACCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018880.1-2121s1c1
Sequence:CCGGCGGAGAGTTCCTCTTCAAATTCTCGAGAATTTGAAGAGGAACTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018880.1-760s1c1
Sequence:CCGGGCTCAGATAAGTGCTGCCTTTCTCGAGAAAGGCAGCACTTATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018880.1-259s1c1
Sequence:CCGGCCCAAAGTTCTGCCTTGTCTACTCGAGTAGACAAGGCAGAACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018880.1-1675s1c1
Sequence:CCGGGACAGCAACAACCAATGTATTCTCGAGAATACATTGGTTGTTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018880.2-1756s21c1
Sequence:CCGGGACACCAATGGAGACATTATTCTCGAGAATAATGTCTCCATTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018880.2-2516s21c1
Sequence:CCGGCCCACGGTTGCACTTTATTTACTCGAGTAAATAAAGTGCAACCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018880.2-2254s21c1
Sequence:CCGGACGTCTGCAGAGCCACTATATCTCGAGATATAGTGGCTCTGCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018880.2-2034s21c1
Sequence:CCGGTGAGATTGTAGTAACGGATTTCTCGAGAAATCCGTTACTACAATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018880.2-2088s21c1
Sequence:CCGGCGGAGAGTTCCTCTTCAAATTCTCGAGAATTTGAAGAGGAACTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018880.2-792s21c1
Sequence:CCGGCAGCGACTTGGAGAGCATTTGCTCGAGCAAATGCTCTCCAAGTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018880
VALIDATED
TRIM3 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018880.1-2549s1c1
Sequence:CCGGCCCACGGTTGCACTTTATTTACTCGAGTAAATAAAGTGCAACCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018880.1-2121s1c1
Sequence:CCGGCGGAGAGTTCCTCTTCAAATTCTCGAGAATTTGAAGAGGAACTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018880.1-760s1c1
Sequence:CCGGGCTCAGATAAGTGCTGCCTTTCTCGAGAAAGGCAGCACTTATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018880.1-259s1c1
Sequence:CCGGCCCAAAGTTCTGCCTTGTCTACTCGAGTAGACAAGGCAGAACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018880.1-1675s1c1
Sequence:CCGGGACAGCAACAACCAATGTATTCTCGAGAATACATTGGTTGTTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018880.2-1756s21c1
Sequence:CCGGGACACCAATGGAGACATTATTCTCGAGAATAATGTCTCCATTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018880.2-2516s21c1
Sequence:CCGGCCCACGGTTGCACTTTATTTACTCGAGTAAATAAAGTGCAACCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018880.2-2254s21c1
Sequence:CCGGACGTCTGCAGAGCCACTATATCTCGAGATATAGTGGCTCTGCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018880.2-2034s21c1
Sequence:CCGGTGAGATTGTAGTAACGGATTTCTCGAGAAATCCGTTACTACAATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018880.2-2088s21c1
Sequence:CCGGCGGAGAGTTCCTCTTCAAATTCTCGAGAATTTGAAGAGGAACTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018880.2-792s21c1
Sequence:CCGGCAGCGACTTGGAGAGCATTTGCTCGAGCAAATGCTCTCCAAGTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018880
VALIDATED
TRIM3 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018880.1-2549s1c1
Sequence:CCGGCCCACGGTTGCACTTTATTTACTCGAGTAAATAAAGTGCAACCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018880.1-2121s1c1
Sequence:CCGGCGGAGAGTTCCTCTTCAAATTCTCGAGAATTTGAAGAGGAACTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018880.1-760s1c1
Sequence:CCGGGCTCAGATAAGTGCTGCCTTTCTCGAGAAAGGCAGCACTTATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018880.1-259s1c1
Sequence:CCGGCCCAAAGTTCTGCCTTGTCTACTCGAGTAGACAAGGCAGAACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018880.1-1675s1c1
Sequence:CCGGGACAGCAACAACCAATGTATTCTCGAGAATACATTGGTTGTTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018880.2-1756s21c1
Sequence:CCGGGACACCAATGGAGACATTATTCTCGAGAATAATGTCTCCATTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018880.2-2516s21c1
Sequence:CCGGCCCACGGTTGCACTTTATTTACTCGAGTAAATAAAGTGCAACCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018880.2-2254s21c1
Sequence:CCGGACGTCTGCAGAGCCACTATATCTCGAGATATAGTGGCTCTGCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018880.2-2034s21c1
Sequence:CCGGTGAGATTGTAGTAACGGATTTCTCGAGAAATCCGTTACTACAATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018880.2-2088s21c1
Sequence:CCGGCGGAGAGTTCCTCTTCAAATTCTCGAGAATTTGAAGAGGAACTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018880.2-792s21c1
Sequence:CCGGCAGCGACTTGGAGAGCATTTGCTCGAGCAAATGCTCTCCAAGTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks