EMAIL THIS PAGE TO A FRIEND

TRIM40

tripartite motif containing 40

Synonyms: RNF35
UniProtKB ID: Q6P9F5, Q5SRJ6, Q5SS36, Q8TD96
Gene ID:
Mouse(195359) tripartite motif-containing 40
Rat(365528) tripartite motif-containing 40
cow(786497) tripartite motif containing 40
sheep(101109221) tripartite motif containing 40
naked mole-rat(101718098) tripartite motif containing 40
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138700 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138700 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138700 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033235 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033235 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033235 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138700 Rosetta Predictions human pricing
NM_001009175 Rosetta Predictions rat pricing
NM_001033235 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363794 predicted 777
2 SASI_Hs02_00363795 predicted 972
3 SASI_Hs02_00363796 predicted 911
4 SASI_Hs01_00073041 predicted 671
5 SASI_Hs02_00363797 predicted 851
6 SASI_Hs02_00363798 predicted 824
7 SASI_Hs01_00073042 predicted 631
8 SASI_Hs01_00073043 predicted 591
9 SASI_Hs01_00073044 predicted 600
10 SASI_Hs02_00363799 predicted 860
11 SASI_Hs01_00073040 predicted 709
12 SASI_Hs01_00073045 predicted 497
13 SASI_Hs01_00073046 predicted 411
14 SASI_Hs01_00073047 predicted 391
15 SASI_Hs01_00073048 predicted 551
16 SASI_Hs01_00073049 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009175 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052204 predicted 288
2 SASI_Rn01_00052205 predicted 322
3 SASI_Rn01_00052206 predicted 334
4 SASI_Rn01_00052207 predicted 287
5 SASI_Rn01_00052208 predicted 246
6 SASI_Rn01_00052209 predicted 324
7 SASI_Rn01_00052210 predicted 325
8 SASI_Rn01_00052211 predicted 294
9 SASI_Rn01_00052212 predicted 481
10 SASI_Rn01_00052213 predicted 455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033235 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175625 predicted 1449
2 SASI_Mm01_00175626 predicted 1383
3 SASI_Mm01_00175627 predicted 1035
4 SASI_Mm01_00175628 predicted 1358
5 SASI_Mm01_00175629 predicted 1222
6 SASI_Mm01_00175631 predicted 1495
7 SASI_Mm01_00175632 predicted 1583
8 SASI_Mm01_00175634 predicted 1563
9 SASI_Mm02_00288361 predicted 1428
10 SASI_Mm02_00288362 predicted 908
11 SASI_Mm01_00175630 predicted 664
12 SASI_Mm01_00175633 predicted 1564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138700
TRIM40 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 40
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138700.2-640s1c1
Sequence:CCGGCCACTACAAGGAACGACTCAACTCGAGTTGAGTCGTTCCTTGTAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011143    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_138700.2-866s1c1
Sequence:CCGGGACACCAACACACTGAAGAATCTCGAGATTCTTCAGTGTGTTGGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138700.2-804s1c1
Sequence:CCGGCCAGGGCAGTAACACAGCTCACTCGAGTGAGCTGTGTTACTGCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138700.2-679s1c1
Sequence:CCGGCAGAAAGGACATTGCAGAACTCTCGAGAGTTCTGCAATGTCCTTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138700.2-781s1c1
Sequence:CCGGAGCGGCCAGAATCCTTGACATCTCGAGATGTCAAGGATTCTGGCCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138700.3-915s21c1
Sequence:CCGGCACAGAAATTAGAGGTTATTTCTCGAGAAATAACCTCTAATTTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138700.3-1241s21c1
Sequence:CCGGCATGGTCTCCAGGAGCATTTGCTCGAGCAAATGCTCCTGGAGACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138700.3-494s21c1
Sequence:CCGGGTGCTAGGGACAGGCTATATCCTCGAGGATATAGCCTGTCCCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138700
TRIM40 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 40
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138700.2-640s1c1
Sequence:CCGGCCACTACAAGGAACGACTCAACTCGAGTTGAGTCGTTCCTTGTAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011143    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_138700.2-866s1c1
Sequence:CCGGGACACCAACACACTGAAGAATCTCGAGATTCTTCAGTGTGTTGGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138700.2-804s1c1
Sequence:CCGGCCAGGGCAGTAACACAGCTCACTCGAGTGAGCTGTGTTACTGCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138700.2-679s1c1
Sequence:CCGGCAGAAAGGACATTGCAGAACTCTCGAGAGTTCTGCAATGTCCTTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138700.2-781s1c1
Sequence:CCGGAGCGGCCAGAATCCTTGACATCTCGAGATGTCAAGGATTCTGGCCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138700.3-915s21c1
Sequence:CCGGCACAGAAATTAGAGGTTATTTCTCGAGAAATAACCTCTAATTTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138700.3-1241s21c1
Sequence:CCGGCATGGTCTCCAGGAGCATTTGCTCGAGCAAATGCTCCTGGAGACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138700.3-494s21c1
Sequence:CCGGGTGCTAGGGACAGGCTATATCCTCGAGGATATAGCCTGTCCCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138700
TRIM40 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 40
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138700.2-640s1c1
Sequence:CCGGCCACTACAAGGAACGACTCAACTCGAGTTGAGTCGTTCCTTGTAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011143    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_138700.2-866s1c1
Sequence:CCGGGACACCAACACACTGAAGAATCTCGAGATTCTTCAGTGTGTTGGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138700.2-804s1c1
Sequence:CCGGCCAGGGCAGTAACACAGCTCACTCGAGTGAGCTGTGTTACTGCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138700.2-679s1c1
Sequence:CCGGCAGAAAGGACATTGCAGAACTCTCGAGAGTTCTGCAATGTCCTTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138700.2-781s1c1
Sequence:CCGGAGCGGCCAGAATCCTTGACATCTCGAGATGTCAAGGATTCTGGCCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138700.3-915s21c1
Sequence:CCGGCACAGAAATTAGAGGTTATTTCTCGAGAAATAACCTCTAATTTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420497    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138700.3-1241s21c1
Sequence:CCGGCATGGTCTCCAGGAGCATTTGCTCGAGCAAATGCTCCTGGAGACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138700.3-494s21c1
Sequence:CCGGGTGCTAGGGACAGGCTATATCCTCGAGGATATAGCCTGTCCCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033235
TRIM40 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 40
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033235.2-1273s21c1
Sequence:CCGGAGGACTTCTCTCTCGTGTTTCCTCGAGGAAACACGAGAGAGAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033235.2-1248s21c1
Sequence:CCGGACAGGAGCGCACCACAGAAATCTCGAGATTTCTGTGGTGCGCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033235.2-1313s21c1
Sequence:CCGGAGTTAGTCTTCCTGGTATATTCTCGAGAATATACCAGGAAGACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033235.2-1437s21c1
Sequence:CCGGCATTTCAGATCTCCATATAACCTCGAGGTTATATGGAGATCTGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033235.2-1122s21c1
Sequence:CCGGAGGAGGTGGCCAAGATCTTTACTCGAGTAAAGATCTTGGCCACCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033235
TRIM40 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 40
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033235.2-1273s21c1
Sequence:CCGGAGGACTTCTCTCTCGTGTTTCCTCGAGGAAACACGAGAGAGAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033235.2-1248s21c1
Sequence:CCGGACAGGAGCGCACCACAGAAATCTCGAGATTTCTGTGGTGCGCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033235.2-1313s21c1
Sequence:CCGGAGTTAGTCTTCCTGGTATATTCTCGAGAATATACCAGGAAGACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033235.2-1437s21c1
Sequence:CCGGCATTTCAGATCTCCATATAACCTCGAGGTTATATGGAGATCTGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033235.2-1122s21c1
Sequence:CCGGAGGAGGTGGCCAAGATCTTTACTCGAGTAAAGATCTTGGCCACCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033235
TRIM40 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 40
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033235.2-1273s21c1
Sequence:CCGGAGGACTTCTCTCTCGTGTTTCCTCGAGGAAACACGAGAGAGAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033235.2-1248s21c1
Sequence:CCGGACAGGAGCGCACCACAGAAATCTCGAGATTTCTGTGGTGCGCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033235.2-1313s21c1
Sequence:CCGGAGTTAGTCTTCCTGGTATATTCTCGAGAATATACCAGGAAGACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033235.2-1437s21c1
Sequence:CCGGCATTTCAGATCTCCATATAACCTCGAGGTTATATGGAGATCTGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033235.2-1122s21c1
Sequence:CCGGAGGAGGTGGCCAAGATCTTTACTCGAGTAAAGATCTTGGCCACCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks