EMAIL THIS PAGE TO A FRIEND

TRIM41

tripartite motif containing 41

Synonyms: RINCK
Gene ID:
Human(90933) Summary: This gene encodes a member of the tripartite motif (TRIM) family. The TRIM family is characterized by a signature motif composed of a RING finger, one or more B-box domains, and a coiled-coil region. This encoded protein may play a role in protein kinase C signaling. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(211007) tripartite motif-containing 41
Rat(303088) tripartite motif-containing 41
chicken(417043) tripartite motif containing 41
domestic cat(101083479) tripartite motif containing 41
dog(491669) tripartite motif containing 41
domestic guinea pig(100733610) tripartite motif containing 41
naked mole-rat(101716177) tripartite motif containing 41
cow(540265) tripartite motif containing 41
sheep(101106681) tripartite motif containing 41
257 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033549 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033549 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033549 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145377 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145377 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145377 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU062791 MISSION® esiRNA esiRNA human TRIM41 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033549 Rosetta Predictions human pricing
NM_201627 Rosetta Predictions human pricing
NM_001134737 Rosetta Predictions rat pricing
NM_145377 Rosetta Predictions mouse pricing
XM_994167 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185492 predicted 1843
2 SASI_Hs01_00185493 predicted 1649
3 SASI_Hs01_00185494 predicted 1384
4 SASI_Hs01_00185495 predicted 1682
5 SASI_Hs01_00185496 predicted 1735
6 SASI_Hs01_00185497 predicted 1687
7 SASI_Hs01_00185498 predicted 1538
8 SASI_Hs01_00185499 predicted 1842
9 SASI_Hs01_00185500 predicted 1931
10 SASI_Hs01_00185501 predicted 1922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104698 predicted 1844
2 SASI_Hs01_00104699 predicted 1654
3 SASI_Hs01_00104700 predicted 1390
4 SASI_Hs01_00104701 predicted 1679
5 SASI_Hs01_00104702 predicted 1734
6 SASI_Hs01_00104703 predicted 1694
7 SASI_Hs01_00104704 predicted 1529
8 SASI_Hs01_00104705 predicted 1850
9 SASI_Hs01_00104706 predicted 1925
10 SASI_Hs01_00104707 predicted 1924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134737 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258264 predicted 2207
2 SASI_Rn02_00258265 predicted 1852
3 SASI_Rn02_00258266 predicted 1854
4 SASI_Rn02_00258267 predicted 1964
5 SASI_Rn02_00258268 predicted 2212
6 SASI_Rn02_00258269 predicted 1517
7 SASI_Rn02_00258270 predicted 1546
8 SASI_Rn02_00258271 predicted 1305
9 SASI_Rn02_00258272 predicted 3090
10 SASI_Rn02_00258273 predicted 2087
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145377 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340669 predicted 2237
2 SASI_Mm02_00340670 predicted 1878
3 SASI_Mm02_00340671 predicted 2721
4 SASI_Mm02_00340672 predicted 2240
5 SASI_Mm02_00340673 predicted 1546
6 SASI_Mm02_00340674 predicted 1679
7 SASI_Mm02_00340675 predicted 2724
8 SASI_Mm02_00340676 predicted 1340
9 SASI_Mm02_00340677 predicted 1875
10 SASI_Mm02_00340678 predicted 2705
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_994167 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242129 predicted 2573
2 SASI_Mm01_00242130 predicted 2568
3 SASI_Mm01_00242131 predicted 2932
4 SASI_Mm01_00242132 predicted 2741
5 SASI_Mm01_00242133 predicted 2572
6 SASI_Mm01_00242134 predicted 2940
7 SASI_Mm01_00242135 predicted 2798
8 SASI_Mm01_00242136 predicted 2688
9 SASI_Mm01_00242137 predicted 2930
10 SASI_Mm01_00242138 predicted 2347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033549
TRIM41 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 41
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033549.3-2672s21c1
Sequence:CCGGGCTCTTCCCACTGCTTGTTACCTCGAGGTAACAAGCAGTGGGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033549.3-2775s21c1
Sequence:CCGGAGCCTTCTCTCACCTACTATGCTCGAGCATAGTAGGTGAGAGAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033549.3-2572s21c1
Sequence:CCGGCAAGCTCTGCCCTTGATTATCCTCGAGGATAATCAAGGGCAGAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033549.3-2354s21c1
Sequence:CCGGACCAACGGCAAACGCTATCAGCTCGAGCTGATAGCGTTTGCCGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033549.3-2732s21c1
Sequence:CCGGTTCTCCCTCTAGGAGCCTAAACTCGAGTTTAGGCTCCTAGAGGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033549.3-2202s1c1
Sequence:CCGGCCCGTGAATCAACCCATCATACTCGAGTATGATGGGTTGATTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033549.3-2524s1c1
Sequence:CCGGCGAGCGTGTCTTTCCTTTCTTCTCGAGAAGAAAGGAAAGACACGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033549.3-1298s1c1
Sequence:CCGGGCCAATATGGTCCAGGTGATTCTCGAGAATCACCTGGACCATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033549.3-1694s1c1
Sequence:CCGGCGTCTCAGAGAGATGCATGAACTCGAGTTCATGCATCTCTCTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033549.3-1844s1c1
Sequence:CCGGGAGACTTTCAATAGGTGTGAACTCGAGTTCACACCTATTGAAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033549
TRIM41 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 41
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033549.3-2672s21c1
Sequence:CCGGGCTCTTCCCACTGCTTGTTACCTCGAGGTAACAAGCAGTGGGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033549.3-2775s21c1
Sequence:CCGGAGCCTTCTCTCACCTACTATGCTCGAGCATAGTAGGTGAGAGAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033549.3-2572s21c1
Sequence:CCGGCAAGCTCTGCCCTTGATTATCCTCGAGGATAATCAAGGGCAGAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033549.3-2354s21c1
Sequence:CCGGACCAACGGCAAACGCTATCAGCTCGAGCTGATAGCGTTTGCCGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033549.3-2732s21c1
Sequence:CCGGTTCTCCCTCTAGGAGCCTAAACTCGAGTTTAGGCTCCTAGAGGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033549.3-2202s1c1
Sequence:CCGGCCCGTGAATCAACCCATCATACTCGAGTATGATGGGTTGATTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033549.3-2524s1c1
Sequence:CCGGCGAGCGTGTCTTTCCTTTCTTCTCGAGAAGAAAGGAAAGACACGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033549.3-1298s1c1
Sequence:CCGGGCCAATATGGTCCAGGTGATTCTCGAGAATCACCTGGACCATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033549.3-1694s1c1
Sequence:CCGGCGTCTCAGAGAGATGCATGAACTCGAGTTCATGCATCTCTCTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033549.3-1844s1c1
Sequence:CCGGGAGACTTTCAATAGGTGTGAACTCGAGTTCACACCTATTGAAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033549
TRIM41 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 41
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033549.3-2672s21c1
Sequence:CCGGGCTCTTCCCACTGCTTGTTACCTCGAGGTAACAAGCAGTGGGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033549.3-2775s21c1
Sequence:CCGGAGCCTTCTCTCACCTACTATGCTCGAGCATAGTAGGTGAGAGAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033549.3-2572s21c1
Sequence:CCGGCAAGCTCTGCCCTTGATTATCCTCGAGGATAATCAAGGGCAGAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033549.3-2354s21c1
Sequence:CCGGACCAACGGCAAACGCTATCAGCTCGAGCTGATAGCGTTTGCCGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428303    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033549.3-2732s21c1
Sequence:CCGGTTCTCCCTCTAGGAGCCTAAACTCGAGTTTAGGCTCCTAGAGGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033549.3-2202s1c1
Sequence:CCGGCCCGTGAATCAACCCATCATACTCGAGTATGATGGGTTGATTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033549.3-2524s1c1
Sequence:CCGGCGAGCGTGTCTTTCCTTTCTTCTCGAGAAGAAAGGAAAGACACGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033549.3-1298s1c1
Sequence:CCGGGCCAATATGGTCCAGGTGATTCTCGAGAATCACCTGGACCATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033549.3-1694s1c1
Sequence:CCGGCGTCTCAGAGAGATGCATGAACTCGAGTTCATGCATCTCTCTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033549.3-1844s1c1
Sequence:CCGGGAGACTTTCAATAGGTGTGAACTCGAGTTCACACCTATTGAAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145377
TRIM41 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 41
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145377.2-1064s21c1
Sequence:CCGGAGTGGTATAGGTGGGTCTAACCTCGAGGTTAGACCCACCTATACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145377.2-1878s21c1
Sequence:CCGGACATCAAGGAGACTTTCAATACTCGAGTATTGAAAGTCTCCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145377.2-3157s21c1
Sequence:CCGGCCACATACATTACCCAATAAACTCGAGTTTATTGGGTAATGTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145377.2-993s21c1
Sequence:CCGGCTATGCGGGAAGAAGATTATGCTCGAGCATAATCTTCTTCCCGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145377.2-2245s21c1
Sequence:CCGGCCGTGAATCAACCCATCATAACTCGAGTTATGATGGGTTGATTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145377
TRIM41 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 41
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145377.2-1064s21c1
Sequence:CCGGAGTGGTATAGGTGGGTCTAACCTCGAGGTTAGACCCACCTATACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145377.2-1878s21c1
Sequence:CCGGACATCAAGGAGACTTTCAATACTCGAGTATTGAAAGTCTCCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145377.2-3157s21c1
Sequence:CCGGCCACATACATTACCCAATAAACTCGAGTTTATTGGGTAATGTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145377.2-993s21c1
Sequence:CCGGCTATGCGGGAAGAAGATTATGCTCGAGCATAATCTTCTTCCCGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145377.2-2245s21c1
Sequence:CCGGCCGTGAATCAACCCATCATAACTCGAGTTATGATGGGTTGATTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145377
TRIM41 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 41
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145377.2-1064s21c1
Sequence:CCGGAGTGGTATAGGTGGGTCTAACCTCGAGGTTAGACCCACCTATACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145377.2-1878s21c1
Sequence:CCGGACATCAAGGAGACTTTCAATACTCGAGTATTGAAAGTCTCCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145377.2-3157s21c1
Sequence:CCGGCCACATACATTACCCAATAAACTCGAGTTTATTGGGTAATGTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145377.2-993s21c1
Sequence:CCGGCTATGCGGGAAGAAGATTATGCTCGAGCATAATCTTCTTCCCGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145377.2-2245s21c1
Sequence:CCGGCCGTGAATCAACCCATCATAACTCGAGTTATGATGGGTTGATTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks