EMAIL THIS PAGE TO A FRIEND

TRIM42

tripartite motif containing 42

Synonyms: PPP1R40
UniProtKB ID: Q8IWZ5, A1L4B4, Q8N832, Q8NDL3
Gene ID:
Human(287015) Summary: This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, namely a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. [provided by RefSeq, Jul 2008]
Mouse(78911) tripartite motif-containing 42
Rat(301106) tripartite motif-containing 42
cow(520038) tripartite motif containing 42
sheep(101108181) tripartite motif containing 42
naked mole-rat(101721515) tripartite motif containing 42
domestic guinea pig(100733910) tripartite motif containing 42
chicken(424818) tripartite motif containing 42
domestic cat(101090205) tripartite motif containing 42
dog(477094) tripartite motif containing 42
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030219 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030219 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030219 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152616 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152616 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152616 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152616 Rosetta Predictions human pricing
NM_001013955 Rosetta Predictions rat pricing
XM_001069825 Rosetta Predictions rat pricing
NM_030219 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366470 predicted 1799
2 SASI_Hs01_00029079 predicted 1373
3 SASI_Hs02_00366471 predicted 1970
4 SASI_Hs01_00029080 predicted 2255
5 SASI_Hs01_00029082 predicted 1424
6 SASI_Hs02_00366472 predicted 1216
7 SASI_Hs01_00029083 predicted 2121
8 SASI_Hs02_00366473 predicted 2147
9 SASI_Hs01_00029085 predicted 1249
10 SASI_Hs01_00029086 predicted 999
11 SASI_Hs01_00029078 predicted 2225
12 SASI_Hs01_00029081 predicted 205
13 SASI_Hs01_00029084 predicted 252
14 SASI_Hs01_00029087 predicted 1442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013955 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050176 predicted 1386
2 SASI_Rn01_00050177 predicted 1406
3 SASI_Rn01_00050178 predicted 2161
4 SASI_Rn01_00050179 predicted 1895
5 SASI_Rn01_00050181 predicted 392
6 SASI_Rn01_00050182 predicted 1356
7 SASI_Rn01_00050183 predicted 1951
8 SASI_Rn01_00050184 predicted 1375
9 SASI_Rn01_00050185 predicted 1344
10 SASI_Rn02_00201277 predicted 1661
11 SASI_Rn01_00050180 predicted 1479
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069825 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329454 predicted 439
2 SASI_Rn02_00329455 predicted 648
3 SASI_Rn02_00329456 predicted 396
4 SASI_Rn02_00329457 predicted 881
5 SASI_Rn02_00329458 predicted 310
6 SASI_Rn02_00329459 predicted 1068
7 SASI_Rn02_00329460 predicted 1276
8 SASI_Rn02_00329461 predicted 895
9 SASI_Rn02_00329462 predicted 1102
10 SASI_Rn02_00329463 predicted 1200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030219 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171212 predicted 404
2 SASI_Mm02_00336646 predicted 2132
3 SASI_Mm02_00336647 predicted 1036
4 SASI_Mm01_00171213 predicted 1173
5 SASI_Mm01_00171214 predicted 1358
6 SASI_Mm01_00171215 predicted 872
7 SASI_Mm02_00336648 predicted 1145
8 SASI_Mm01_00171216 predicted 1384
9 SASI_Mm01_00171217 predicted 2181
10 SASI_Mm01_00171218 predicted 1626
11 SASI_Mm01_00171219 predicted 1678
12 SASI_Mm01_00171220 predicted 1381
13 SASI_Mm01_00171221 predicted 489
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030219
TRIM42 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 42
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030219.1-2301s1c1
Sequence:CCGGCCTCAGAACTCTACTGCTCATCTCGAGATGAGCAGTAGAGTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030219.1-1362s1c1
Sequence:CCGGCGACCATGAAAGTGAACGAAACTCGAGTTTCGTTCACTTTCATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030219.1-1140s1c1
Sequence:CCGGCCAAGTTCAAAGCAGTCCGATCTCGAGATCGGACTGCTTTGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030219.1-751s1c1
Sequence:CCGGGCGCCTTACTAAACGCTACATCTCGAGATGTAGCGTTTAGTAAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030219.1-402s1c1
Sequence:CCGGGCCGCAATGTTACCATCACATCTCGAGATGTGATGGTAACATTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030219.2-2071s21c1
Sequence:CCGGTGTGGACAAATTCGCGACATCCTCGAGGATGTCGCGAATTTGTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030219.2-2148s21c1
Sequence:CCGGGGTTAGAGCCATCAATGATAACTCGAGTTATCATTGATGGCTCTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030219.2-2001s21c1
Sequence:CCGGCGTGGACTCCTTTGAGATGGACTCGAGTCCATCTCAAAGGAGTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030219.2-2047s21c1
Sequence:CCGGCCTAATAATGTGCGCACAGAGCTCGAGCTCTGTGCGCACATTATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030219
TRIM42 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 42
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030219.1-2301s1c1
Sequence:CCGGCCTCAGAACTCTACTGCTCATCTCGAGATGAGCAGTAGAGTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030219.1-1362s1c1
Sequence:CCGGCGACCATGAAAGTGAACGAAACTCGAGTTTCGTTCACTTTCATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030219.1-1140s1c1
Sequence:CCGGCCAAGTTCAAAGCAGTCCGATCTCGAGATCGGACTGCTTTGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030219.1-751s1c1
Sequence:CCGGGCGCCTTACTAAACGCTACATCTCGAGATGTAGCGTTTAGTAAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030219.1-402s1c1
Sequence:CCGGGCCGCAATGTTACCATCACATCTCGAGATGTGATGGTAACATTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030219.2-2071s21c1
Sequence:CCGGTGTGGACAAATTCGCGACATCCTCGAGGATGTCGCGAATTTGTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030219.2-2148s21c1
Sequence:CCGGGGTTAGAGCCATCAATGATAACTCGAGTTATCATTGATGGCTCTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030219.2-2001s21c1
Sequence:CCGGCGTGGACTCCTTTGAGATGGACTCGAGTCCATCTCAAAGGAGTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030219.2-2047s21c1
Sequence:CCGGCCTAATAATGTGCGCACAGAGCTCGAGCTCTGTGCGCACATTATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030219
TRIM42 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 42
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030219.1-2301s1c1
Sequence:CCGGCCTCAGAACTCTACTGCTCATCTCGAGATGAGCAGTAGAGTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030219.1-1362s1c1
Sequence:CCGGCGACCATGAAAGTGAACGAAACTCGAGTTTCGTTCACTTTCATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030219.1-1140s1c1
Sequence:CCGGCCAAGTTCAAAGCAGTCCGATCTCGAGATCGGACTGCTTTGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030219.1-751s1c1
Sequence:CCGGGCGCCTTACTAAACGCTACATCTCGAGATGTAGCGTTTAGTAAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030219.1-402s1c1
Sequence:CCGGGCCGCAATGTTACCATCACATCTCGAGATGTGATGGTAACATTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030219.2-2071s21c1
Sequence:CCGGTGTGGACAAATTCGCGACATCCTCGAGGATGTCGCGAATTTGTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030219.2-2148s21c1
Sequence:CCGGGGTTAGAGCCATCAATGATAACTCGAGTTATCATTGATGGCTCTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030219.2-2001s21c1
Sequence:CCGGCGTGGACTCCTTTGAGATGGACTCGAGTCCATCTCAAAGGAGTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030219.2-2047s21c1
Sequence:CCGGCCTAATAATGTGCGCACAGAGCTCGAGCTCTGTGCGCACATTATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152616
TRIM42 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 42
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152616.3-2386s1c1
Sequence:CCGGCCTCAGACTCATCACAAAGTACTCGAGTACTTTGTGATGAGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152616.3-233s1c1
Sequence:CCGGGCAGAGATGTTGTCCTCAGTTCTCGAGAACTGAGGACAACATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152616.3-479s1c1
Sequence:CCGGCCGCAATACCATCATCACTTTCTCGAGAAAGTGATGATGGTATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152616.3-1228s1c1
Sequence:CCGGCAGTCCGATATGAAATTGATACTCGAGTATCAATTTCATATCGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152616.3-2202s1c1
Sequence:CCGGCCCAACACAGAATACGTGTTTCTCGAGAAACACGTATTCTGTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152616.3-1588s21c1
Sequence:CCGGAGCTCCGGCTGCACTCAATAACTCGAGTTATTGAGTGCAGCCGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152616.3-445s21c1
Sequence:CCGGATCTCAACTGCTACTACTATGCTCGAGCATAGTAGTAGCAGTTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152616.3-1003s21c1
Sequence:CCGGCCATGCAAGACCACGTCTTTGCTCGAGCAAAGACGTGGTCTTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152616
TRIM42 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 42
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152616.3-2386s1c1
Sequence:CCGGCCTCAGACTCATCACAAAGTACTCGAGTACTTTGTGATGAGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152616.3-233s1c1
Sequence:CCGGGCAGAGATGTTGTCCTCAGTTCTCGAGAACTGAGGACAACATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152616.3-479s1c1
Sequence:CCGGCCGCAATACCATCATCACTTTCTCGAGAAAGTGATGATGGTATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152616.3-1228s1c1
Sequence:CCGGCAGTCCGATATGAAATTGATACTCGAGTATCAATTTCATATCGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152616.3-2202s1c1
Sequence:CCGGCCCAACACAGAATACGTGTTTCTCGAGAAACACGTATTCTGTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152616.3-1588s21c1
Sequence:CCGGAGCTCCGGCTGCACTCAATAACTCGAGTTATTGAGTGCAGCCGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152616.3-445s21c1
Sequence:CCGGATCTCAACTGCTACTACTATGCTCGAGCATAGTAGTAGCAGTTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152616.3-1003s21c1
Sequence:CCGGCCATGCAAGACCACGTCTTTGCTCGAGCAAAGACGTGGTCTTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152616
TRIM42 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 42
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152616.3-2386s1c1
Sequence:CCGGCCTCAGACTCATCACAAAGTACTCGAGTACTTTGTGATGAGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152616.3-233s1c1
Sequence:CCGGGCAGAGATGTTGTCCTCAGTTCTCGAGAACTGAGGACAACATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152616.3-479s1c1
Sequence:CCGGCCGCAATACCATCATCACTTTCTCGAGAAAGTGATGATGGTATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152616.3-1228s1c1
Sequence:CCGGCAGTCCGATATGAAATTGATACTCGAGTATCAATTTCATATCGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152616.3-2202s1c1
Sequence:CCGGCCCAACACAGAATACGTGTTTCTCGAGAAACACGTATTCTGTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152616.3-1588s21c1
Sequence:CCGGAGCTCCGGCTGCACTCAATAACTCGAGTTATTGAGTGCAGCCGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152616.3-445s21c1
Sequence:CCGGATCTCAACTGCTACTACTATGCTCGAGCATAGTAGTAGCAGTTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152616.3-1003s21c1
Sequence:CCGGCCATGCAAGACCACGTCTTTGCTCGAGCAAAGACGTGGTCTTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks