EMAIL THIS PAGE TO A FRIEND

TRIM43B

tripartite motif containing 43B

UniProtKB ID: A6NCK2
Gene ID:
Human(653192) Summary: This gene encodes a member of a family of proteins containing RING-finger, SPRY, and BBC domains. There is no definitive support for transcription of this locus, and the transcript structure is inferred from other family members. [provided by RefSeq, Oct 2009]
Mouse(666747) tripartite motif-containing 43B
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_926437 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_926437 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_926437 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_926437 Rosetta Predictions human pricing
XM_001480610 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00480364 predicted 654
2 SASI_Hs02_00480365 predicted 501
3 SASI_Hs02_00480366 predicted 533
4 SASI_Hs02_00480367 predicted 826
5 SASI_Hs02_00480368 predicted 815
6 SASI_Hs02_00480369 predicted 792
7 SASI_Hs02_00480370 predicted 540
8 SASI_Hs02_00480371 predicted 984
9 SASI_Hs02_00480372 predicted 658
10 SASI_Hs02_00480373 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480610 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00418749 predicted 549
2 SASI_Mm02_00418750 predicted 710
3 SASI_Mm02_00418751 predicted 769
4 SASI_Mm02_00418752 predicted 807
5 SASI_Mm02_00418753 predicted 710
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_926437
TRIM43B MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 43B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926437.3-1226s21c1
Sequence:CCGGGTTAACTCTGAGGACATATTTCTCGAGAAATATGTCCTCAGAGTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926437.3-978s21c1
Sequence:CCGGACCGCTTCCGAGTGGAAATTTCTCGAGAAATTTCCACTCGGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926437.3-1258s21c1
Sequence:CCGGTCTGAAGGTGGATAATCATTTCTCGAGAAATGATTATCCACCTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926437.3-536s21c1
Sequence:CCGGGACCGGGAGAAACTCTTAAAGCTCGAGCTTTAAGAGTTTCTCCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_926437.3-1491s21c1
Sequence:CCGGCTGTTTGGGAACTCCATATACCTCGAGGTATATGGAGTTCCCAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_926437
TRIM43B MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 43B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926437.3-1226s21c1
Sequence:CCGGGTTAACTCTGAGGACATATTTCTCGAGAAATATGTCCTCAGAGTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926437.3-978s21c1
Sequence:CCGGACCGCTTCCGAGTGGAAATTTCTCGAGAAATTTCCACTCGGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926437.3-1258s21c1
Sequence:CCGGTCTGAAGGTGGATAATCATTTCTCGAGAAATGATTATCCACCTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926437.3-536s21c1
Sequence:CCGGGACCGGGAGAAACTCTTAAAGCTCGAGCTTTAAGAGTTTCTCCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_926437.3-1491s21c1
Sequence:CCGGCTGTTTGGGAACTCCATATACCTCGAGGTATATGGAGTTCCCAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_926437
TRIM43B MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 43B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926437.3-1226s21c1
Sequence:CCGGGTTAACTCTGAGGACATATTTCTCGAGAAATATGTCCTCAGAGTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926437.3-978s21c1
Sequence:CCGGACCGCTTCCGAGTGGAAATTTCTCGAGAAATTTCCACTCGGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926437.3-1258s21c1
Sequence:CCGGTCTGAAGGTGGATAATCATTTCTCGAGAAATGATTATCCACCTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926437.3-536s21c1
Sequence:CCGGGACCGGGAGAAACTCTTAAAGCTCGAGCTTTAAGAGTTTCTCCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_926437.3-1491s21c1
Sequence:CCGGCTGTTTGGGAACTCCATATACCTCGAGGTATATGGAGTTCCCAAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks