EMAIL THIS PAGE TO A FRIEND

TRIM44

tripartite motif containing 44

Synonyms: DIPB HSA249128 MC7
UniProtKB ID: Q96DX7, D3DR14, Q96QY2, Q9UGK0
Gene ID:
Human(54765) Summary: This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, namely a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. [provided by RefSeq, Jul 2008]
Mouse(80985) tripartite motif-containing 44
Rat(362172) tripartite motif-containing 44
Zebrafish(793099) tripartite motif-containing 44
domestic cat(101098987) tripartite motif containing 44
dog(483424) tripartite motif containing 44
cow(782816) tripartite motif containing 44
sheep(101114642) tripartite motif containing 44
domestic guinea pig(100730881) tripartite motif containing 44
naked mole-rat(101699466) tripartite motif containing 44
182 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020267 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020267 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020267 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017583 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017583 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017583 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017583 Rosetta Predictions human pricing
NM_001013203 Rosetta Predictions rat pricing
NM_020267 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017583 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030329 predicted 1562
2 SASI_Hs01_00030330 predicted 1618
3 SASI_Hs01_00030331 predicted 1619
4 SASI_Hs01_00030332 predicted 1244
5 SASI_Hs01_00030333 predicted 1399
6 SASI_Hs02_00350248 predicted 1667
7 SASI_Hs01_00030334 predicted 1062
8 SASI_Hs01_00030335 predicted 1048
9 SASI_Hs01_00030336 predicted 1477
10 SASI_Hs01_00030337 predicted 1603
11 SASI_Hs01_00030338 predicted 1389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013203 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038708 predicted 682
2 SASI_Rn01_00038710 predicted 691
3 SASI_Rn01_00038711 predicted 751
4 SASI_Rn02_00200981 predicted 749
5 SASI_Rn01_00038712 predicted 699
6 SASI_Rn01_00038714 predicted 745
7 SASI_Rn01_00038715 predicted 664
8 SASI_Rn01_00038716 predicted 633
9 SASI_Rn02_00200982 predicted 717
10 SASI_Rn02_00200983 predicted 783
11 SASI_Rn01_00038707 predicted 805
12 SASI_Rn01_00038709 predicted 768
13 SASI_Rn01_00038713 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020267 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325455 predicted 1100
2 SASI_Mm01_00142010 predicted 774
3 SASI_Mm01_00142011 predicted 1343
4 SASI_Mm01_00142012 predicted 1301
5 SASI_Mm01_00142013 predicted 1110
6 SASI_Mm01_00142014 predicted 925
7 SASI_Mm01_00142015 predicted 1151
8 SASI_Mm01_00142016 predicted 1162
9 SASI_Mm01_00142017 predicted 994
10 SASI_Mm01_00142018 predicted 980
11 SASI_Mm01_00142009 predicted 764
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020267
VALIDATED
TRIM44 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 44
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020267.2-779s21c1
Sequence:CCGGGCACCTATTGTCAGGAAGATACTCGAGTATCTTCCTGACAATAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020267.2-529s21c1
Sequence:CCGGGTAGACAGTGAGTCGGAAGAACTCGAGTTCTTCCGACTCACTGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020267.2-916s21c1
Sequence:CCGGGCAATGATAGAGTTGGTGGAACTCGAGTTCCACCAACTCTATCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020267.2-1747s21c1
Sequence:CCGGTGTTAGGGCAACTGGGTTAAACTCGAGTTTAACCCAGTTGCCCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020267.2-973s21c1
Sequence:CCGGCGAGACCAGATGAAGATATTTCTCGAGAAATATCTTCATCTGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020267.1-475s1c1
Sequence:CCGGGTAGACAGTGAGTCGGAAGAACTCGAGTTCTTCCGACTCACTGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020267.1-922s1c1
Sequence:CCGGCGAGACCAGATGAAGATATTTCTCGAGAAATATCTTCATCTGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020267.1-1065s1c1
Sequence:CCGGCCAATCTCACATGGATAGGTTCTCGAGAACCTATCCATGTGAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020267.1-728s1c1
Sequence:CCGGGCACCTATTGTCAGGAAGATACTCGAGTATCTTCCTGACAATAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020267.1-865s1c1
Sequence:CCGGGCAATGATAGAGTTGGTGGAACTCGAGTTCCACCAACTCTATCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020267
VALIDATED
TRIM44 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 44
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020267.2-779s21c1
Sequence:CCGGGCACCTATTGTCAGGAAGATACTCGAGTATCTTCCTGACAATAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020267.2-529s21c1
Sequence:CCGGGTAGACAGTGAGTCGGAAGAACTCGAGTTCTTCCGACTCACTGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020267.2-916s21c1
Sequence:CCGGGCAATGATAGAGTTGGTGGAACTCGAGTTCCACCAACTCTATCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020267.2-1747s21c1
Sequence:CCGGTGTTAGGGCAACTGGGTTAAACTCGAGTTTAACCCAGTTGCCCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020267.2-973s21c1
Sequence:CCGGCGAGACCAGATGAAGATATTTCTCGAGAAATATCTTCATCTGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020267.1-475s1c1
Sequence:CCGGGTAGACAGTGAGTCGGAAGAACTCGAGTTCTTCCGACTCACTGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020267.1-922s1c1
Sequence:CCGGCGAGACCAGATGAAGATATTTCTCGAGAAATATCTTCATCTGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020267.1-1065s1c1
Sequence:CCGGCCAATCTCACATGGATAGGTTCTCGAGAACCTATCCATGTGAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020267.1-728s1c1
Sequence:CCGGGCACCTATTGTCAGGAAGATACTCGAGTATCTTCCTGACAATAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020267.1-865s1c1
Sequence:CCGGGCAATGATAGAGTTGGTGGAACTCGAGTTCCACCAACTCTATCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020267
VALIDATED
TRIM44 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 44
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020267.2-779s21c1
Sequence:CCGGGCACCTATTGTCAGGAAGATACTCGAGTATCTTCCTGACAATAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020267.2-529s21c1
Sequence:CCGGGTAGACAGTGAGTCGGAAGAACTCGAGTTCTTCCGACTCACTGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020267.2-916s21c1
Sequence:CCGGGCAATGATAGAGTTGGTGGAACTCGAGTTCCACCAACTCTATCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020267.2-1747s21c1
Sequence:CCGGTGTTAGGGCAACTGGGTTAAACTCGAGTTTAACCCAGTTGCCCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_020267.2-973s21c1
Sequence:CCGGCGAGACCAGATGAAGATATTTCTCGAGAAATATCTTCATCTGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020267.1-475s1c1
Sequence:CCGGGTAGACAGTGAGTCGGAAGAACTCGAGTTCTTCCGACTCACTGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020267.1-922s1c1
Sequence:CCGGCGAGACCAGATGAAGATATTTCTCGAGAAATATCTTCATCTGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020267.1-1065s1c1
Sequence:CCGGCCAATCTCACATGGATAGGTTCTCGAGAACCTATCCATGTGAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020267.1-728s1c1
Sequence:CCGGGCACCTATTGTCAGGAAGATACTCGAGTATCTTCCTGACAATAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020267.1-865s1c1
Sequence:CCGGGCAATGATAGAGTTGGTGGAACTCGAGTTCCACCAACTCTATCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017583
VALIDATED
TRIM44 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 44
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017583.4-728s21c1
Sequence:CCGGGCCGAAGAAGACAACCAAGAACTCGAGTTCTTGGTTGTCTTCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_017583.4-1320s21c1
Sequence:CCGGCCAGTGAAGAAGAGGACACATCTCGAGATGTGTCCTCTTCTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017583.4-855s21c1
Sequence:CCGGGGCTTGATTTGAGTACCTATTCTCGAGAATAGGTACTCAAATCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017583.4-1786s21c1
Sequence:CCGGGAGCAAGGTAGGGCCAAATTACTCGAGTAATTTGGCCCTACCTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_017583.3-1061s1c1
Sequence:CCGGCGGGACCAAATGAAGATGTTTCTCGAGAAACATCTTCATTTGGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017583.3-1004s1c1
Sequence:CCGGGCTATGATCGAATTGGTGGAACTCGAGTTCCACCAATTCGATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017583
VALIDATED
TRIM44 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 44
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017583.4-728s21c1
Sequence:CCGGGCCGAAGAAGACAACCAAGAACTCGAGTTCTTGGTTGTCTTCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_017583.4-1320s21c1
Sequence:CCGGCCAGTGAAGAAGAGGACACATCTCGAGATGTGTCCTCTTCTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017583.4-855s21c1
Sequence:CCGGGGCTTGATTTGAGTACCTATTCTCGAGAATAGGTACTCAAATCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017583.4-1786s21c1
Sequence:CCGGGAGCAAGGTAGGGCCAAATTACTCGAGTAATTTGGCCCTACCTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_017583.3-1061s1c1
Sequence:CCGGCGGGACCAAATGAAGATGTTTCTCGAGAAACATCTTCATTTGGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017583.3-1004s1c1
Sequence:CCGGGCTATGATCGAATTGGTGGAACTCGAGTTCCACCAATTCGATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017583
VALIDATED
TRIM44 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 44
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017583.4-728s21c1
Sequence:CCGGGCCGAAGAAGACAACCAAGAACTCGAGTTCTTGGTTGTCTTCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_017583.4-1320s21c1
Sequence:CCGGCCAGTGAAGAAGAGGACACATCTCGAGATGTGTCCTCTTCTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_017583.4-855s21c1
Sequence:CCGGGGCTTGATTTGAGTACCTATTCTCGAGAATAGGTACTCAAATCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017583.4-1786s21c1
Sequence:CCGGGAGCAAGGTAGGGCCAAATTACTCGAGTAATTTGGCCCTACCTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_017583.3-1061s1c1
Sequence:CCGGCGGGACCAAATGAAGATGTTTCTCGAGAAACATCTTCATTTGGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017583.3-1004s1c1
Sequence:CCGGGCTATGATCGAATTGGTGGAACTCGAGTTCCACCAATTCGATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks