EMAIL THIS PAGE TO A FRIEND

TRIM45

tripartite motif containing 45

Synonyms: RNF99
UniProtKB ID: Q9H8W5, Q53GN0, Q5T2K4, Q5T2K5, Q8IYV6
Gene ID:
Human(80263) Summary: This gene encodes a member of the tripartite motif family. The encoded protein may function as a transcriptional repressor of the mitogen-activated protein kinase pathway. Alternatively spliced transcript variants have been described.[provided by RefSeq, Mar 2009]
Mouse(229644) tripartite motif-containing 45
Rat(295323) tripartite motif-containing 45
naked mole-rat(101699839) tripartite motif containing 45
Domestic Rabbit(100347753) tripartite motif containing 45
domestic guinea pig(100712971) tripartite motif containing 45
cow(539091) tripartite motif containing 45
sheep(101107483) tripartite motif containing 45
Zebrafish(558117) tripartite motif containing 45
dog(475811) tripartite motif containing 45
domestic cat(101086331) tripartite motif containing 45
chicken(769776) tripartite motif containing 45
Gene Class: ATPase
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194343 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_194343 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_194343 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025188 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025188 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025188 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025188 Rosetta Predictions human pricing
NM_001106453 Rosetta Predictions rat pricing
NM_194343 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089399 predicted 1738
2 SASI_Hs01_00089400 predicted 1960
3 SASI_Hs01_00089401 predicted 1994
4 SASI_Hs02_00357954 predicted 2105
5 SASI_Hs01_00089402 predicted 906
6 SASI_Hs01_00089403 predicted 1767
7 SASI_Hs01_00089404 predicted 2432
8 SASI_Hs01_00089406 predicted 1754
9 SASI_Hs01_00089407 predicted 1600
10 SASI_Hs01_00089408 predicted 1249
11 SASI_Hs01_00089405 predicted 1929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106453 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219108 predicted 1743
2 SASI_Rn02_00219109 predicted 1956
3 SASI_Rn02_00219110 predicted 994
4 SASI_Rn02_00219111 predicted 1681
5 SASI_Rn02_00219112 predicted 1506
6 SASI_Rn02_00219113 predicted 1112
7 SASI_Rn02_00219114 predicted 1824
8 SASI_Rn02_00219115 predicted 1627
9 SASI_Rn02_00219116 predicted 794
10 SASI_Rn02_00219117 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194343 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350630 predicted 369
2 SASI_Mm01_00069423 predicted 784
3 SASI_Mm01_00069425 predicted 2136
4 SASI_Mm01_00069426 predicted 1602
5 SASI_Mm01_00069427 predicted 1763
6 SASI_Mm02_00350631 predicted 997
7 SASI_Mm01_00069428 predicted 1314
8 SASI_Mm01_00069429 predicted 1121
9 SASI_Mm01_00069430 predicted 610
10 SASI_Mm01_00069431 predicted 1557
11 SASI_Mm01_00069422 predicted 845
12 SASI_Mm01_00069424 predicted 1364
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194343
VALIDATED
TRIM45 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 45
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115556    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194343.1-2435s1c1
Sequence:CCGGGCCCATCATTTGTTTGTTGTACTCGAGTACAACAAACAAATGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194343.1-371s1c1
Sequence:CCGGGCAAGACTCATTGTCCTACATCTCGAGATGTAGGACAATGAGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194343.1-1311s1c1
Sequence:CCGGCTCGGACTTAGAGATTCTCATCTCGAGATGAGAATCTCTAAGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194343.1-787s1c1
Sequence:CCGGCGACAGAAGAAGACGACATATCTCGAGATATGTCGTCTTCTTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194343.1-964s1c1
Sequence:CCGGCCCTATGACTTCACCAGCAATCTCGAGATTGCTGGTGAAGTCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194343
VALIDATED
TRIM45 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 45
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115556    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194343.1-2435s1c1
Sequence:CCGGGCCCATCATTTGTTTGTTGTACTCGAGTACAACAAACAAATGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194343.1-371s1c1
Sequence:CCGGGCAAGACTCATTGTCCTACATCTCGAGATGTAGGACAATGAGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194343.1-1311s1c1
Sequence:CCGGCTCGGACTTAGAGATTCTCATCTCGAGATGAGAATCTCTAAGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194343.1-787s1c1
Sequence:CCGGCGACAGAAGAAGACGACATATCTCGAGATATGTCGTCTTCTTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194343.1-964s1c1
Sequence:CCGGCCCTATGACTTCACCAGCAATCTCGAGATTGCTGGTGAAGTCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194343
VALIDATED
TRIM45 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 45
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115556    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194343.1-2435s1c1
Sequence:CCGGGCCCATCATTTGTTTGTTGTACTCGAGTACAACAAACAAATGATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194343.1-371s1c1
Sequence:CCGGGCAAGACTCATTGTCCTACATCTCGAGATGTAGGACAATGAGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194343.1-1311s1c1
Sequence:CCGGCTCGGACTTAGAGATTCTCATCTCGAGATGAGAATCTCTAAGTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194343.1-787s1c1
Sequence:CCGGCGACAGAAGAAGACGACATATCTCGAGATATGTCGTCTTCTTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194343.1-964s1c1
Sequence:CCGGCCCTATGACTTCACCAGCAATCTCGAGATTGCTGGTGAAGTCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025188
TRIM45 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 45
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025188.1-1292s1c1
Sequence:CCGGCCTGGCTCAGATCCACATAATCTCGAGATTATGTGGATCTGAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025188.1-556s1c1
Sequence:CCGGGCTTTGTAAGCAAACTCACTACTCGAGTAGTGAGTTTGCTTACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025188.1-1722s1c1
Sequence:CCGGCCAGCCAAATGTGTCCTACAACTCGAGTTGTAGGACACATTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025188.1-1618s1c1
Sequence:CCGGCCCGTCCTGGAGTAAATGATACTCGAGTATCATTTACTCCAGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025188.1-2171s1c1
Sequence:CCGGCCACTGGTCATGCTGTGGAAACTCGAGTTTCCACAGCATGACCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025188.3-2000s21c1
Sequence:CCGGCCAAGGAACCTGGCGTCTATACTCGAGTATAGACGCCAGGTTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417632    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025188.3-2388s21c1
Sequence:CCGGGACCCAGACCTTCGTTCATTCCTCGAGGAATGAACGAAGGTCTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025188
TRIM45 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 45
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025188.1-1292s1c1
Sequence:CCGGCCTGGCTCAGATCCACATAATCTCGAGATTATGTGGATCTGAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025188.1-556s1c1
Sequence:CCGGGCTTTGTAAGCAAACTCACTACTCGAGTAGTGAGTTTGCTTACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025188.1-1722s1c1
Sequence:CCGGCCAGCCAAATGTGTCCTACAACTCGAGTTGTAGGACACATTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025188.1-1618s1c1
Sequence:CCGGCCCGTCCTGGAGTAAATGATACTCGAGTATCATTTACTCCAGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025188.1-2171s1c1
Sequence:CCGGCCACTGGTCATGCTGTGGAAACTCGAGTTTCCACAGCATGACCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025188.3-2000s21c1
Sequence:CCGGCCAAGGAACCTGGCGTCTATACTCGAGTATAGACGCCAGGTTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417632    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025188.3-2388s21c1
Sequence:CCGGGACCCAGACCTTCGTTCATTCCTCGAGGAATGAACGAAGGTCTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025188
TRIM45 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 45
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025188.1-1292s1c1
Sequence:CCGGCCTGGCTCAGATCCACATAATCTCGAGATTATGTGGATCTGAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025188.1-556s1c1
Sequence:CCGGGCTTTGTAAGCAAACTCACTACTCGAGTAGTGAGTTTGCTTACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025188.1-1722s1c1
Sequence:CCGGCCAGCCAAATGTGTCCTACAACTCGAGTTGTAGGACACATTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025188.1-1618s1c1
Sequence:CCGGCCCGTCCTGGAGTAAATGATACTCGAGTATCATTTACTCCAGGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025188.1-2171s1c1
Sequence:CCGGCCACTGGTCATGCTGTGGAAACTCGAGTTTCCACAGCATGACCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025188.3-2000s21c1
Sequence:CCGGCCAAGGAACCTGGCGTCTATACTCGAGTATAGACGCCAGGTTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417632    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025188.3-2388s21c1
Sequence:CCGGGACCCAGACCTTCGTTCATTCCTCGAGGAATGAACGAAGGTCTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks