EMAIL THIS PAGE TO A FRIEND

TRIM46

tripartite motif containing 46

Synonyms: GENEY TRIFIC
Gene ID:
Mouse(360213) tripartite motif-containing 46
Rat(310641) tripartite motif-containing 46
Zebrafish(569905) tripartite motif containing 46
Horse(100057262) tripartite motif containing 46
domestic cat(101094079) tripartite motif containing 46
dog(490429) tripartite motif containing 46
cow(535897) tripartite motif containing 46
sheep(101105874) tripartite motif containing 46
domestic guinea pig(100733251) tripartite motif containing 46
Domestic Rabbit(100357399) tripartite motif containing 46
naked mole-rat(101706641) tripartite motif containing 46
268 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025058 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025058 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025058 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039466 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039466 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039466 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017403 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017403 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017403 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025058 Rosetta Predictions human pricing
NM_001107691 Rosetta Predictions rat pricing
NM_001039466 Rosetta Predictions mouse pricing
NM_183037 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357719 predicted 1257
2 SASI_Hs01_00110979 predicted 1395
3 SASI_Hs02_00357720 predicted 2554
4 SASI_Hs01_00110980 predicted 846
5 SASI_Hs01_00110982 predicted 748
6 SASI_Hs01_00110983 predicted 1168
7 SASI_Hs01_00110985 predicted 2590
8 SASI_Hs01_00110986 predicted 776
9 SASI_Hs01_00110987 predicted 2757
10 SASI_Hs01_00110988 predicted 898
11 SASI_Hs01_00110981 predicted 2498
12 SASI_Hs01_00110984 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107691 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231325 predicted 845
2 SASI_Rn02_00231326 predicted 845
3 SASI_Rn02_00231327 predicted 1525
4 SASI_Rn02_00231328 predicted 692
5 SASI_Rn02_00231329 predicted 2152
6 SASI_Rn02_00231330 predicted 1046
7 SASI_Rn02_00231331 predicted 1398
8 SASI_Rn02_00231332 predicted 1622
9 SASI_Rn02_00231333 predicted 695
10 SASI_Rn02_00231334 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039466 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167148 predicted 709
2 SASI_Mm01_00167150 predicted 318
3 SASI_Mm01_00167151 predicted 2144
4 SASI_Mm01_00167152 predicted 837
5 SASI_Mm01_00167153 predicted 719
6 SASI_Mm01_00167154 predicted 571
7 SASI_Mm01_00167155 predicted 1944
8 SASI_Mm01_00167156 predicted 517
9 SASI_Mm01_00167157 predicted 846
10 SASI_Mm02_00290057 predicted 688
11 SASI_Mm01_00167149 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183037 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350042 predicted 936
2 SASI_Mm01_00069054 predicted 942
3 SASI_Mm01_00069055 predicted 2646
4 SASI_Mm02_00350043 predicted 789
5 SASI_Mm01_00069056 predicted 2506
6 SASI_Mm01_00069057 predicted 2870
7 SASI_Mm01_00069058 predicted 1225
8 SASI_Mm01_00069059 predicted 2432
9 SASI_Mm01_00069062 predicted 1372
10 SASI_Mm01_00069063 predicted 827
11 SASI_Mm01_00069060 predicted 2739
12 SASI_Mm01_00069061 predicted 2735
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025058
TRIM46 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 46
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025058.3-2564s21c1
Sequence:CCGGGTTCTCTCCATTGCTTGTTAGCTCGAGCTAACAAGCAATGGAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025058.3-2617s21c1
Sequence:CCGGGACCTGCCTTTGGCATGTTACCTCGAGGTAACATGCCAAAGGCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025058.2-1948s1c1
Sequence:CCGGCCCTTCGCTTTCCTAACCATTCTCGAGAATGGTTAGGAAAGCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025058.2-831s1c1
Sequence:CCGGCCTGACATACATCCTGGGAAACTCGAGTTTCCCAGGATGTATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025058.2-54s1c1
Sequence:CCGGCCGCATCAGTACCAGCATGAACTCGAGTTCATGCTGGTACTGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025058.2-1377s1c1
Sequence:CCGGCTGGCACTATACCGTTGAGTTCTCGAGAACTCAACGGTATAGTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025058.2-1257s1c1
Sequence:CCGGGCTGCTGACAGAGCTTAACTTCTCGAGAAGTTAAGCTCTGTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025058
TRIM46 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 46
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025058.3-2564s21c1
Sequence:CCGGGTTCTCTCCATTGCTTGTTAGCTCGAGCTAACAAGCAATGGAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025058.3-2617s21c1
Sequence:CCGGGACCTGCCTTTGGCATGTTACCTCGAGGTAACATGCCAAAGGCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025058.2-1948s1c1
Sequence:CCGGCCCTTCGCTTTCCTAACCATTCTCGAGAATGGTTAGGAAAGCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025058.2-831s1c1
Sequence:CCGGCCTGACATACATCCTGGGAAACTCGAGTTTCCCAGGATGTATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025058.2-54s1c1
Sequence:CCGGCCGCATCAGTACCAGCATGAACTCGAGTTCATGCTGGTACTGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025058.2-1377s1c1
Sequence:CCGGCTGGCACTATACCGTTGAGTTCTCGAGAACTCAACGGTATAGTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025058.2-1257s1c1
Sequence:CCGGGCTGCTGACAGAGCTTAACTTCTCGAGAAGTTAAGCTCTGTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025058
TRIM46 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 46
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025058.3-2564s21c1
Sequence:CCGGGTTCTCTCCATTGCTTGTTAGCTCGAGCTAACAAGCAATGGAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025058.3-2617s21c1
Sequence:CCGGGACCTGCCTTTGGCATGTTACCTCGAGGTAACATGCCAAAGGCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025058.2-1948s1c1
Sequence:CCGGCCCTTCGCTTTCCTAACCATTCTCGAGAATGGTTAGGAAAGCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025058.2-831s1c1
Sequence:CCGGCCTGACATACATCCTGGGAAACTCGAGTTTCCCAGGATGTATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025058.2-54s1c1
Sequence:CCGGCCGCATCAGTACCAGCATGAACTCGAGTTCATGCTGGTACTGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025058.2-1377s1c1
Sequence:CCGGCTGGCACTATACCGTTGAGTTCTCGAGAACTCAACGGTATAGTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025058.2-1257s1c1
Sequence:CCGGGCTGCTGACAGAGCTTAACTTCTCGAGAAGTTAAGCTCTGTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039466
VALIDATED
TRIM46 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 46
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001039466.1-1028s21c1
Sequence:CCGGATGCCAGCAAGAGCGCTTATCCTCGAGGATAAGCGCTCTTGCTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001039466.1-825s21c1
Sequence:CCGGCTCAAGGATAAGCTAACAAAGCTCGAGCTTTGTTAGCTTATCCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001039466.1-1334s21c1
Sequence:CCGGCACCTTTGCCTATGATCAAATCTCGAGATTTGATCATAGGCAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039466.1-1110s21c1
Sequence:CCGGTATGCGCAGGAAGTCCTTAAGCTCGAGCTTAAGGACTTCCTGCGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216860    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001039466.1-2333s1c1
Sequence:CCGGGGAACACTGGATATGACTAACCTCGAGGTTAGTCATATCCAGTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039466.1-2333s21c1
Sequence:CCGGGGAACACTGGATATGACTAACCTCGAGGTTAGTCATATCCAGTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039466
VALIDATED
TRIM46 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 46
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001039466.1-1028s21c1
Sequence:CCGGATGCCAGCAAGAGCGCTTATCCTCGAGGATAAGCGCTCTTGCTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001039466.1-825s21c1
Sequence:CCGGCTCAAGGATAAGCTAACAAAGCTCGAGCTTTGTTAGCTTATCCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001039466.1-1334s21c1
Sequence:CCGGCACCTTTGCCTATGATCAAATCTCGAGATTTGATCATAGGCAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039466.1-1110s21c1
Sequence:CCGGTATGCGCAGGAAGTCCTTAAGCTCGAGCTTAAGGACTTCCTGCGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216860    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001039466.1-2333s1c1
Sequence:CCGGGGAACACTGGATATGACTAACCTCGAGGTTAGTCATATCCAGTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039466.1-2333s21c1
Sequence:CCGGGGAACACTGGATATGACTAACCTCGAGGTTAGTCATATCCAGTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039466
VALIDATED
TRIM46 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 46
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001039466.1-1028s21c1
Sequence:CCGGATGCCAGCAAGAGCGCTTATCCTCGAGGATAAGCGCTCTTGCTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001039466.1-825s21c1
Sequence:CCGGCTCAAGGATAAGCTAACAAAGCTCGAGCTTTGTTAGCTTATCCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001039466.1-1334s21c1
Sequence:CCGGCACCTTTGCCTATGATCAAATCTCGAGATTTGATCATAGGCAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039466.1-1110s21c1
Sequence:CCGGTATGCGCAGGAAGTCCTTAAGCTCGAGCTTAAGGACTTCCTGCGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216860    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001039466.1-2333s1c1
Sequence:CCGGGGAACACTGGATATGACTAACCTCGAGGTTAGTCATATCCAGTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039466.1-2333s21c1
Sequence:CCGGGGAACACTGGATATGACTAACCTCGAGGTTAGTCATATCCAGTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017403
TRIM46 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 46
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000181032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017403.1-811s1c1
Sequence:CCGGCCTTCTGTAACGAATGCTTCACTCGAGTGAAGCATTCGTTACAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017403.1-348s1c1
Sequence:CCGGGAGATGTACAAGCAGCCACTACTCGAGTAGTGGCTGCTTGTACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017403
TRIM46 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 46
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000181032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017403.1-811s1c1
Sequence:CCGGCCTTCTGTAACGAATGCTTCACTCGAGTGAAGCATTCGTTACAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017403.1-348s1c1
Sequence:CCGGGAGATGTACAAGCAGCCACTACTCGAGTAGTGGCTGCTTGTACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017403
TRIM46 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 46
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000181032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017403.1-811s1c1
Sequence:CCGGCCTTCTGTAACGAATGCTTCACTCGAGTGAAGCATTCGTTACAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017403.1-348s1c1
Sequence:CCGGGAGATGTACAAGCAGCCACTACTCGAGTAGTGGCTGCTTGTACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks