EMAIL THIS PAGE TO A FRIEND

TRIM47

tripartite motif containing 47

Synonyms: GOA RNF100
UniProtKB ID: Q96LD4, Q96GU5, Q9BRN7
Gene ID:
Mouse(217333) tripartite motif-containing 47
Rat(690374) tripartite motif-containing 47
Zebrafish(393254) tripartite motif containing 47
Horse(100059340) tripartite motif containing 47
domestic cat(101095452) tripartite motif containing 47
dog(609519) tripartite motif containing 47
chicken(770100) tripartite motif containing 47
naked mole-rat(101701787) tripartite motif containing 47
domestic guinea pig(100720192) tripartite motif containing 47
cow(618638) tripartite motif containing 47
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033452 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033452 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033452 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172570 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172570 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172570 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033452 Rosetta Predictions human pricing
NM_001109585 Rosetta Predictions rat pricing
NM_172570 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226135 predicted 1298
2 SASI_Hs01_00226136 predicted 1204
3 SASI_Hs01_00226137 predicted 973
4 SASI_Hs02_00361341 predicted 1266
5 SASI_Hs02_00361342 predicted 1113
6 SASI_Hs01_00226138 predicted 1251
7 SASI_Hs01_00226139 predicted 1870
8 SASI_Hs02_00361343 predicted 1090
9 SASI_Hs01_00226140 predicted 1331
10 SASI_Hs01_00226142 predicted 1703
11 SASI_Hs01_00226141 predicted 1284
12 SASI_Hs01_00226143 predicted 1299
13 SASI_Hs01_00226144 predicted 1006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109585 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249831 predicted 1429
2 SASI_Rn02_00249832 predicted 1003
3 SASI_Rn02_00249833 predicted 692
4 SASI_Rn02_00249834 predicted 1585
5 SASI_Rn02_00249835 predicted 1283
6 SASI_Rn02_00249836 predicted 1410
7 SASI_Rn02_00249837 predicted 832
8 SASI_Rn02_00249838 predicted 1085
9 SASI_Rn02_00249839 predicted 1405
10 SASI_Rn02_00249840 predicted 1578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172570 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184877 predicted 1058
2 SASI_Mm01_00184878 predicted 784
3 SASI_Mm02_00344229 predicted 1626
4 SASI_Mm01_00184880 predicted 1454
5 SASI_Mm01_00184881 predicted 1667
6 SASI_Mm01_00184882 predicted 1353
7 SASI_Mm01_00184883 predicted 611
8 SASI_Mm01_00184884 predicted 752
9 SASI_Mm01_00184885 predicted 867
10 SASI_Mm02_00344230 predicted 249
11 SASI_Mm01_00184876 predicted 1871
12 SASI_Mm01_00184879 predicted 828
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033452
VALIDATED
TRIM47 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 47
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034049    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_033452.1-2039s1c1
Sequence:CCGGCCACACACCCAGCCTTCTCATCTCGAGATGAGAAGGCTGGGTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034051    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_033452.1-1594s1c1
Sequence:CCGGGCAGTGGAATGGACGCAGCTTCTCGAGAAGCTGCGTCCATTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034050    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_033452.1-1303s1c1
Sequence:CCGGGTTTGCCTATATTGTGGATTTCTCGAGAAATCCACAATATAGGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034052    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_033452.1-1105s1c1
Sequence:CCGGCACCAAATCATCCCAAGCTGTCTCGAGACAGCTTGGGATGATTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034053    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_033452.1-1909s1c1
Sequence:CCGGCAAGAAGTCCTGCATATCCGTCTCGAGACGGATATGCAGGACTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033452.2-1377s21c1
Sequence:CCGGGAGGGTGCTGTGTCCTATCAACTCGAGTTGATAGGACACAGCACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033452.2-1474s21c1
Sequence:CCGGTACTGGGAGGTGGAGATTATCCTCGAGGATAATCTCCACCTCCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033452.2-2038s21c1
Sequence:CCGGCCACACACCCAGCCTTCTCATCTCGAGATGAGAAGGCTGGGTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033452.2-1908s21c1
Sequence:CCGGCAAGAAGTCCTGCATATCCGTCTCGAGACGGATATGCAGGACTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033452.2-1275s21c1
Sequence:CCGGTGAAGCTCCCAGGGACTATTTCTCGAGAAATAGTCCCTGGGAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033452
VALIDATED
TRIM47 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 47
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034049    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_033452.1-2039s1c1
Sequence:CCGGCCACACACCCAGCCTTCTCATCTCGAGATGAGAAGGCTGGGTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034051    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_033452.1-1594s1c1
Sequence:CCGGGCAGTGGAATGGACGCAGCTTCTCGAGAAGCTGCGTCCATTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034050    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_033452.1-1303s1c1
Sequence:CCGGGTTTGCCTATATTGTGGATTTCTCGAGAAATCCACAATATAGGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034052    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_033452.1-1105s1c1
Sequence:CCGGCACCAAATCATCCCAAGCTGTCTCGAGACAGCTTGGGATGATTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034053    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_033452.1-1909s1c1
Sequence:CCGGCAAGAAGTCCTGCATATCCGTCTCGAGACGGATATGCAGGACTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033452.2-1377s21c1
Sequence:CCGGGAGGGTGCTGTGTCCTATCAACTCGAGTTGATAGGACACAGCACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033452.2-1474s21c1
Sequence:CCGGTACTGGGAGGTGGAGATTATCCTCGAGGATAATCTCCACCTCCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033452.2-2038s21c1
Sequence:CCGGCCACACACCCAGCCTTCTCATCTCGAGATGAGAAGGCTGGGTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033452.2-1908s21c1
Sequence:CCGGCAAGAAGTCCTGCATATCCGTCTCGAGACGGATATGCAGGACTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033452.2-1275s21c1
Sequence:CCGGTGAAGCTCCCAGGGACTATTTCTCGAGAAATAGTCCCTGGGAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033452
VALIDATED
TRIM47 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 47
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034049    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_033452.1-2039s1c1
Sequence:CCGGCCACACACCCAGCCTTCTCATCTCGAGATGAGAAGGCTGGGTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034051    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_033452.1-1594s1c1
Sequence:CCGGGCAGTGGAATGGACGCAGCTTCTCGAGAAGCTGCGTCCATTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034050    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_033452.1-1303s1c1
Sequence:CCGGGTTTGCCTATATTGTGGATTTCTCGAGAAATCCACAATATAGGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034052    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_033452.1-1105s1c1
Sequence:CCGGCACCAAATCATCCCAAGCTGTCTCGAGACAGCTTGGGATGATTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034053    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_033452.1-1909s1c1
Sequence:CCGGCAAGAAGTCCTGCATATCCGTCTCGAGACGGATATGCAGGACTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033452.2-1377s21c1
Sequence:CCGGGAGGGTGCTGTGTCCTATCAACTCGAGTTGATAGGACACAGCACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033452.2-1474s21c1
Sequence:CCGGTACTGGGAGGTGGAGATTATCCTCGAGGATAATCTCCACCTCCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033452.2-2038s21c1
Sequence:CCGGCCACACACCCAGCCTTCTCATCTCGAGATGAGAAGGCTGGGTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033452.2-1908s21c1
Sequence:CCGGCAAGAAGTCCTGCATATCCGTCTCGAGACGGATATGCAGGACTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033452.2-1275s21c1
Sequence:CCGGTGAAGCTCCCAGGGACTATTTCTCGAGAAATAGTCCCTGGGAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172570
TRIM47 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 47
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172570.2-1875s1c1
Sequence:CCGGCCTCTCAAGAAATCGTGCATACTCGAGTATGCACGATTTCTTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172570.2-1265s1c1
Sequence:CCGGCTTCCTCAAGTTTGCCTACATCTCGAGATGTAGGCAAACTTGAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172570.2-1650s1c1
Sequence:CCGGTGCCTAGAGTATGCAGACCATCTCGAGATGGTCTGCATACTCTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172570.2-1874s1c1
Sequence:CCGGACCTCTCAAGAAATCGTGCATCTCGAGATGCACGATTTCTTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172570.2-1182s1c1
Sequence:CCGGCTACAGAAACTCGGCTCAGAACTCGAGTTCTGAGCCGAGTTTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172570.4-988s21c1
Sequence:CCGGCTACAGAAACTCGGCTCAGAACTCGAGTTCTGAGCCGAGTTTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172570.4-631s21c1
Sequence:CCGGACAGCCACCCTTCAGAGTTTCCTCGAGGAAACTCTGAAGGGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172570.4-1681s21c1
Sequence:CCGGCCTCTCAAGAAATCGTGCATACTCGAGTATGCACGATTTCTTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172570.4-602s21c1
Sequence:CCGGAGAGGGTGAGCCAGATGTTTGCTCGAGCAAACATCTGGCTCACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172570.4-785s21c1
Sequence:CCGGAGGCGGATTCAGTCAGCTTTCCTCGAGGAAAGCTGACTGAATCCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172570
TRIM47 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 47
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172570.2-1875s1c1
Sequence:CCGGCCTCTCAAGAAATCGTGCATACTCGAGTATGCACGATTTCTTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172570.2-1265s1c1
Sequence:CCGGCTTCCTCAAGTTTGCCTACATCTCGAGATGTAGGCAAACTTGAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172570.2-1650s1c1
Sequence:CCGGTGCCTAGAGTATGCAGACCATCTCGAGATGGTCTGCATACTCTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172570.2-1874s1c1
Sequence:CCGGACCTCTCAAGAAATCGTGCATCTCGAGATGCACGATTTCTTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172570.2-1182s1c1
Sequence:CCGGCTACAGAAACTCGGCTCAGAACTCGAGTTCTGAGCCGAGTTTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172570.4-988s21c1
Sequence:CCGGCTACAGAAACTCGGCTCAGAACTCGAGTTCTGAGCCGAGTTTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172570.4-631s21c1
Sequence:CCGGACAGCCACCCTTCAGAGTTTCCTCGAGGAAACTCTGAAGGGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172570.4-1681s21c1
Sequence:CCGGCCTCTCAAGAAATCGTGCATACTCGAGTATGCACGATTTCTTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172570.4-602s21c1
Sequence:CCGGAGAGGGTGAGCCAGATGTTTGCTCGAGCAAACATCTGGCTCACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172570.4-785s21c1
Sequence:CCGGAGGCGGATTCAGTCAGCTTTCCTCGAGGAAAGCTGACTGAATCCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172570
TRIM47 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 47
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172570.2-1875s1c1
Sequence:CCGGCCTCTCAAGAAATCGTGCATACTCGAGTATGCACGATTTCTTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172570.2-1265s1c1
Sequence:CCGGCTTCCTCAAGTTTGCCTACATCTCGAGATGTAGGCAAACTTGAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172570.2-1650s1c1
Sequence:CCGGTGCCTAGAGTATGCAGACCATCTCGAGATGGTCTGCATACTCTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172570.2-1874s1c1
Sequence:CCGGACCTCTCAAGAAATCGTGCATCTCGAGATGCACGATTTCTTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172570.2-1182s1c1
Sequence:CCGGCTACAGAAACTCGGCTCAGAACTCGAGTTCTGAGCCGAGTTTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172570.4-988s21c1
Sequence:CCGGCTACAGAAACTCGGCTCAGAACTCGAGTTCTGAGCCGAGTTTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172570.4-631s21c1
Sequence:CCGGACAGCCACCCTTCAGAGTTTCCTCGAGGAAACTCTGAAGGGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172570.4-1681s21c1
Sequence:CCGGCCTCTCAAGAAATCGTGCATACTCGAGTATGCACGATTTCTTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172570.4-602s21c1
Sequence:CCGGAGAGGGTGAGCCAGATGTTTGCTCGAGCAAACATCTGGCTCACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172570.4-785s21c1
Sequence:CCGGAGGCGGATTCAGTCAGCTTTCCTCGAGGAAAGCTGACTGAATCCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks