EMAIL THIS PAGE TO A FRIEND

TRIM48

tripartite motif containing 48

Synonyms: RNF101
Species: Human TRIM48(79097)
UniProtKB ID: Q8IWZ4, Q9BUW4
Gene ID:
11 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024114 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024114 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024114 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148831 MISSION® esiRNA esiRNA human TRIM48 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024114
TRIM48 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 48
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024114.3-1089s21c1
Sequence:CCGGCCAATTACACTGCAGTATGTCCTCGAGGACATACTGCAGTGTAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024114.3-1223s21c1
Sequence:CCGGACTTCCTCTCAGACCTATCTTCTCGAGAAGATAGGTCTGAGAGGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024114.3-776s21c1
Sequence:CCGGGCATCACAATGAAGCCAACAGCTCGAGCTGTTGGCTTCATTGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024114.2-272s1c1
Sequence:CCGGCCCAATTCTTACTCAGTGCTTCTCGAGAAGCACTGAGTAAGAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024114.2-399s1c1
Sequence:CCGGGAGGAGCAAATGTGTGGCATTCTCGAGAATGCCACACATTTGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024114.2-608s1c1
Sequence:CCGGGAATGTGGAAACCACCAGAATCTCGAGATTCTGGTGGTTTCCACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024114.2-182s1c1
Sequence:CCGGCATCTGCATGAACTACTTCATCTCGAGATGAAGTAGTTCATGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024114.2-422s1c1
Sequence:CCGGCAGGGAGACAAAGAAGATGTTCTCGAGAACATCTTCTTTGTCTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024114
TRIM48 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 48
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024114.3-1089s21c1
Sequence:CCGGCCAATTACACTGCAGTATGTCCTCGAGGACATACTGCAGTGTAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024114.3-1223s21c1
Sequence:CCGGACTTCCTCTCAGACCTATCTTCTCGAGAAGATAGGTCTGAGAGGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024114.3-776s21c1
Sequence:CCGGGCATCACAATGAAGCCAACAGCTCGAGCTGTTGGCTTCATTGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024114.2-272s1c1
Sequence:CCGGCCCAATTCTTACTCAGTGCTTCTCGAGAAGCACTGAGTAAGAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024114.2-399s1c1
Sequence:CCGGGAGGAGCAAATGTGTGGCATTCTCGAGAATGCCACACATTTGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024114.2-608s1c1
Sequence:CCGGGAATGTGGAAACCACCAGAATCTCGAGATTCTGGTGGTTTCCACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024114.2-182s1c1
Sequence:CCGGCATCTGCATGAACTACTTCATCTCGAGATGAAGTAGTTCATGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024114.2-422s1c1
Sequence:CCGGCAGGGAGACAAAGAAGATGTTCTCGAGAACATCTTCTTTGTCTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024114
TRIM48 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 48
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024114.3-1089s21c1
Sequence:CCGGCCAATTACACTGCAGTATGTCCTCGAGGACATACTGCAGTGTAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024114.3-1223s21c1
Sequence:CCGGACTTCCTCTCAGACCTATCTTCTCGAGAAGATAGGTCTGAGAGGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024114.3-776s21c1
Sequence:CCGGGCATCACAATGAAGCCAACAGCTCGAGCTGTTGGCTTCATTGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024114.2-272s1c1
Sequence:CCGGCCCAATTCTTACTCAGTGCTTCTCGAGAAGCACTGAGTAAGAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024114.2-399s1c1
Sequence:CCGGGAGGAGCAAATGTGTGGCATTCTCGAGAATGCCACACATTTGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024114.2-608s1c1
Sequence:CCGGGAATGTGGAAACCACCAGAATCTCGAGATTCTGGTGGTTTCCACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024114.2-182s1c1
Sequence:CCGGCATCTGCATGAACTACTTCATCTCGAGATGAAGTAGTTCATGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024114.2-422s1c1
Sequence:CCGGCAGGGAGACAAAGAAGATGTTCTCGAGAACATCTTCTTTGTCTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks