EMAIL THIS PAGE TO A FRIEND

TRIM49

tripartite motif containing 49

Synonyms: RNF18 TRIM49A TRIM49L2
Species: Human TRIM49(57093)
UniProtKB ID: P0CI25, A0AVR7, A0AVR9, Q6DJV1, Q9NS80
Gene ID:
Human(57093) Summary: The protein encoded by this gene contains a RING zinc finger, a motif known to be involved in protein-protein interactions. This gene has been found to be preferentially expressed in testis. Related pseudogenes and gene duplicates have also been identified on chromosome 11. [provided by RefSeq, Aug 2010]
15 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020358 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020358 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020358 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127251 MISSION® esiRNA esiRNA human TRIM49 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020358
TRIM49 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 49
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020358.2-377s1c1
Sequence:CCGGCCTGTGCATGAACTACTTCATCTCGAGATGAAGTAGTTCATGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020358.2-829s1c1
Sequence:CCGGGCTGGAAGGATTATGTGAATTCTCGAGAATTCACATAATCCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020358.2-1025s1c1
Sequence:CCGGGCTGAACGAAATGTGCCATAACTCGAGTTATGGCACATTTCGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020358.2-1413s1c1
Sequence:CCGGCGGAAAGAGAAGAATCAGAATCTCGAGATTCTGATTCTTCTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020358.2-1616s1c1
Sequence:CCGGCCTAATATACACCATCCCTAACTCGAGTTAGGGATGGTGTATATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020358.2-1545s21c1
Sequence:CCGGACCAGCCGAGTAGGATTATTCCTCGAGGAATAATCCTACTCGGCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020358.2-1915s21c1
Sequence:CCGGATGATCATGGCATACAGTATACTCGAGTATACTGTATGCCATGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020358.2-1330s21c1
Sequence:CCGGAGACTTTCACCTCGGGCAAATCTCGAGATTTGCCCGAGGTGAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020358
TRIM49 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 49
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020358.2-377s1c1
Sequence:CCGGCCTGTGCATGAACTACTTCATCTCGAGATGAAGTAGTTCATGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020358.2-829s1c1
Sequence:CCGGGCTGGAAGGATTATGTGAATTCTCGAGAATTCACATAATCCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020358.2-1025s1c1
Sequence:CCGGGCTGAACGAAATGTGCCATAACTCGAGTTATGGCACATTTCGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020358.2-1413s1c1
Sequence:CCGGCGGAAAGAGAAGAATCAGAATCTCGAGATTCTGATTCTTCTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020358.2-1616s1c1
Sequence:CCGGCCTAATATACACCATCCCTAACTCGAGTTAGGGATGGTGTATATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020358.2-1545s21c1
Sequence:CCGGACCAGCCGAGTAGGATTATTCCTCGAGGAATAATCCTACTCGGCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020358.2-1915s21c1
Sequence:CCGGATGATCATGGCATACAGTATACTCGAGTATACTGTATGCCATGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020358.2-1330s21c1
Sequence:CCGGAGACTTTCACCTCGGGCAAATCTCGAGATTTGCCCGAGGTGAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020358
TRIM49 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 49
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020358.2-377s1c1
Sequence:CCGGCCTGTGCATGAACTACTTCATCTCGAGATGAAGTAGTTCATGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020358.2-829s1c1
Sequence:CCGGGCTGGAAGGATTATGTGAATTCTCGAGAATTCACATAATCCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020358.2-1025s1c1
Sequence:CCGGGCTGAACGAAATGTGCCATAACTCGAGTTATGGCACATTTCGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020358.2-1413s1c1
Sequence:CCGGCGGAAAGAGAAGAATCAGAATCTCGAGATTCTGATTCTTCTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020358.2-1616s1c1
Sequence:CCGGCCTAATATACACCATCCCTAACTCGAGTTAGGGATGGTGTATATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020358.2-1545s21c1
Sequence:CCGGACCAGCCGAGTAGGATTATTCCTCGAGGAATAATCCTACTCGGCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020358.2-1915s21c1
Sequence:CCGGATGATCATGGCATACAGTATACTCGAGTATACTGTATGCCATGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020358.2-1330s21c1
Sequence:CCGGAGACTTTCACCTCGGGCAAATCTCGAGATTTGCCCGAGGTGAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks