EMAIL THIS PAGE TO A FRIEND

TRIM49B

tripartite motif containing 49B

Species: Human TRIM49B(283116)
UniProtKB ID: A6NDI0
Gene ID:
3 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001720988 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001720988 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001720988 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001720988 Rosetta Predictions human pricing
XM_001725141 Rosetta Predictions human pricing
XM_208043 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720988 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00440070 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00465878 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_208043 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278325 predicted 454
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001720988
TRIM49B MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 49B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000237952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720988.1-1271s21c1
Sequence:CCGGCCATCAAGATGTACCCTATTTCTCGAGAAATAGGGTACATCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001720988.1-1917s21c1
Sequence:CCGGGATCATGGCATACAGTATATTCTCGAGAATATACTGTATGCCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720988.1-1544s21c1
Sequence:CCGGTACCAGCCGAGTAGGATTATTCTCGAGAATAATCCTACTCGGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720988.1-1332s21c1
Sequence:CCGGACTTTCACCTCGGGCAAATATCTCGAGATATTTGCCCGAGGTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720988.1-1016s21c1
Sequence:CCGGGTATGAGGAGCTGAACGAAATCTCGAGATTTCGTTCAGCTCCTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001720988
TRIM49B MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 49B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000237952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720988.1-1271s21c1
Sequence:CCGGCCATCAAGATGTACCCTATTTCTCGAGAAATAGGGTACATCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001720988.1-1917s21c1
Sequence:CCGGGATCATGGCATACAGTATATTCTCGAGAATATACTGTATGCCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720988.1-1544s21c1
Sequence:CCGGTACCAGCCGAGTAGGATTATTCTCGAGAATAATCCTACTCGGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720988.1-1332s21c1
Sequence:CCGGACTTTCACCTCGGGCAAATATCTCGAGATATTTGCCCGAGGTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720988.1-1016s21c1
Sequence:CCGGGTATGAGGAGCTGAACGAAATCTCGAGATTTCGTTCAGCTCCTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001720988
TRIM49B MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 49B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000237952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720988.1-1271s21c1
Sequence:CCGGCCATCAAGATGTACCCTATTTCTCGAGAAATAGGGTACATCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001720988.1-1917s21c1
Sequence:CCGGGATCATGGCATACAGTATATTCTCGAGAATATACTGTATGCCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720988.1-1544s21c1
Sequence:CCGGTACCAGCCGAGTAGGATTATTCTCGAGAATAATCCTACTCGGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720988.1-1332s21c1
Sequence:CCGGACTTTCACCTCGGGCAAATATCTCGAGATATTTGCCCGAGGTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720988.1-1016s21c1
Sequence:CCGGGTATGAGGAGCTGAACGAAATCTCGAGATTTCGTTCAGCTCCTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks