EMAIL THIS PAGE TO A FRIEND

TRIM49C

tripartite motif containing 49C

Synonyms: TRIM49L2
Species: Human TRIM49C(642612)
UniProtKB ID: P0CI26, A0AVR7, A0AVR9, Q6DJV1, Q9NS80
Gene ID:
2 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_926089 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_926089 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_926089 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_926089
TRIM49C MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 49C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926089.1-80s21c1
Sequence:CCGGTGGCCTTGTGCGTGCTGATATCTCGAGATATCAGCACGCACAAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926089.1-435s21c1
Sequence:CCGGTAGCACAATGTTTAACTCTAACTCGAGTTAGAGTTAAACATTGTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926089.1-517s21c1
Sequence:CCGGCCAATGTTTCCTCACTATGTACTCGAGTACATAGTGAGGAAACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926089.1-231s21c1
Sequence:CCGGAGGAACCAATTACAATATCGGCTCGAGCCGATATTGTAATTGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926089.1-103s21c1
Sequence:CCGGTCACAGATGAGTGAGTCCGTGCTCGAGCACGGACTCACTCATCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_926089
TRIM49C MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 49C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926089.1-80s21c1
Sequence:CCGGTGGCCTTGTGCGTGCTGATATCTCGAGATATCAGCACGCACAAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926089.1-435s21c1
Sequence:CCGGTAGCACAATGTTTAACTCTAACTCGAGTTAGAGTTAAACATTGTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926089.1-517s21c1
Sequence:CCGGCCAATGTTTCCTCACTATGTACTCGAGTACATAGTGAGGAAACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926089.1-231s21c1
Sequence:CCGGAGGAACCAATTACAATATCGGCTCGAGCCGATATTGTAATTGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926089.1-103s21c1
Sequence:CCGGTCACAGATGAGTGAGTCCGTGCTCGAGCACGGACTCACTCATCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_926089
TRIM49C MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 49C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926089.1-80s21c1
Sequence:CCGGTGGCCTTGTGCGTGCTGATATCTCGAGATATCAGCACGCACAAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926089.1-435s21c1
Sequence:CCGGTAGCACAATGTTTAACTCTAACTCGAGTTAGAGTTAAACATTGTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926089.1-517s21c1
Sequence:CCGGCCAATGTTTCCTCACTATGTACTCGAGTACATAGTGAGGAAACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926089.1-231s21c1
Sequence:CCGGAGGAACCAATTACAATATCGGCTCGAGCCGATATTGTAATTGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_926089.1-103s21c1
Sequence:CCGGTCACAGATGAGTGAGTCCGTGCTCGAGCACGGACTCACTCATCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks