EMAIL THIS PAGE TO A FRIEND

TRIM4

tripartite motif containing 4

Synonyms: RNF87
UniProtKB ID: Q9C037, A4D298, Q75MK1, Q96F06, Q9C036
Gene ID:
Human(89122) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Its function has not been identified. Alternatively spliced transcript variants that encode different isoforms have been described.[provided by RefSeq, Jul 2010]
dog(608654) tripartite motif containing 4
domestic cat(101097197) tripartite motif containing 4
Domestic Rabbit(100349797) tripartite motif containing 4
cow(527577) tripartite motif containing 4
sheep(101111684) tripartite motif containing 4
162 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033017 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033017 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033017 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU093951 MISSION® esiRNA esiRNA human TRIM4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033017 Rosetta Predictions human pricing
NM_033091 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033017 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211339 predicted 1039
2 SASI_Hs01_00211340 predicted 1421
3 SASI_Hs01_00211341 predicted 1128
4 SASI_Hs01_00211342 predicted 1099
5 SASI_Hs01_00211343 predicted 1071
6 SASI_Hs01_00211344 predicted 1369
7 SASI_Hs01_00211345 predicted 1337
8 SASI_Hs01_00211346 predicted 1272
9 SASI_Hs01_00211347 predicted 1488
10 SASI_Hs01_00211348 predicted 1220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247161 predicted 962
2 SASI_Hs01_00247162 predicted 1348
3 SASI_Hs01_00247163 predicted 1046
4 SASI_Hs01_00247164 predicted 1012
5 SASI_Hs01_00247165 predicted 990
6 SASI_Hs01_00247166 predicted 1292
7 SASI_Hs01_00247167 predicted 1255
8 SASI_Hs01_00247168 predicted 1187
9 SASI_Hs01_00247169 predicted 1406
10 SASI_Hs01_00247170 predicted 1143
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033017
VALIDATED
TRIM4 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_033017.2-823s21c1
Sequence:CCGGGCTGAATGAGAACACGTTAAACTCGAGTTTAACGTGTTCTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033017.2-1370s21c1
Sequence:CCGGGTGGGCATCTGGGCGATTTATCTCGAGATAAATCGCCCAGATGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033017.2-2830s21c1
Sequence:CCGGAGTTATGCACTACTAACATTTCTCGAGAAATGTTAGTAGTGCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_033017.2-609s21c1
Sequence:GTACCGGTTCTTAAGTCTCAGCGTAATCCTCGAGGATTACGCTGAGACTTAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033017.2-1590s21c1
Sequence:CCGGCATTAGCATCTTTAGTCATTCCTCGAGGAATGACTAAAGATGCTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_033017.2-859s1c1
Sequence:CCGGCGCTTCATTGAAGAAGCTCATCTCGAGATGAGCTTCTTCAATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033017.2-574s1c1
Sequence:CCGGGCTGCTCTTGTACCATTCTAACTCGAGTTAGAATGGTACAAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033017.2-1039s1c1
Sequence:CCGGGCGATTCCAAGTGGCTGTAAACTCGAGTTTACAGCCACTTGGAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_033017.2-1611s1c1
Sequence:CCGGCACCAGTGACTGATAGGAAATCTCGAGATTTCCTATCAGTCACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_033017.2-823s1c1
Sequence:CCGGGCTGAATGAGAACACGTTAAACTCGAGTTTAACGTGTTCTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033017
VALIDATED
TRIM4 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_033017.2-823s21c1
Sequence:CCGGGCTGAATGAGAACACGTTAAACTCGAGTTTAACGTGTTCTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033017.2-1370s21c1
Sequence:CCGGGTGGGCATCTGGGCGATTTATCTCGAGATAAATCGCCCAGATGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033017.2-2830s21c1
Sequence:CCGGAGTTATGCACTACTAACATTTCTCGAGAAATGTTAGTAGTGCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_033017.2-609s21c1
Sequence:GTACCGGTTCTTAAGTCTCAGCGTAATCCTCGAGGATTACGCTGAGACTTAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033017.2-1590s21c1
Sequence:CCGGCATTAGCATCTTTAGTCATTCCTCGAGGAATGACTAAAGATGCTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_033017.2-859s1c1
Sequence:CCGGCGCTTCATTGAAGAAGCTCATCTCGAGATGAGCTTCTTCAATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033017.2-574s1c1
Sequence:CCGGGCTGCTCTTGTACCATTCTAACTCGAGTTAGAATGGTACAAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033017.2-1039s1c1
Sequence:CCGGGCGATTCCAAGTGGCTGTAAACTCGAGTTTACAGCCACTTGGAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_033017.2-1611s1c1
Sequence:CCGGCACCAGTGACTGATAGGAAATCTCGAGATTTCCTATCAGTCACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_033017.2-823s1c1
Sequence:CCGGGCTGAATGAGAACACGTTAAACTCGAGTTTAACGTGTTCTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033017
VALIDATED
TRIM4 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_033017.2-823s21c1
Sequence:CCGGGCTGAATGAGAACACGTTAAACTCGAGTTTAACGTGTTCTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033017.2-1370s21c1
Sequence:CCGGGTGGGCATCTGGGCGATTTATCTCGAGATAAATCGCCCAGATGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033017.2-2830s21c1
Sequence:CCGGAGTTATGCACTACTAACATTTCTCGAGAAATGTTAGTAGTGCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_033017.2-609s21c1
Sequence:GTACCGGTTCTTAAGTCTCAGCGTAATCCTCGAGGATTACGCTGAGACTTAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033017.2-1590s21c1
Sequence:CCGGCATTAGCATCTTTAGTCATTCCTCGAGGAATGACTAAAGATGCTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_033017.2-859s1c1
Sequence:CCGGCGCTTCATTGAAGAAGCTCATCTCGAGATGAGCTTCTTCAATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033017.2-574s1c1
Sequence:CCGGGCTGCTCTTGTACCATTCTAACTCGAGTTAGAATGGTACAAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033017.2-1039s1c1
Sequence:CCGGGCGATTCCAAGTGGCTGTAAACTCGAGTTTACAGCCACTTGGAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_033017.2-1611s1c1
Sequence:CCGGCACCAGTGACTGATAGGAAATCTCGAGATTTCCTATCAGTCACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_033017.2-823s1c1
Sequence:CCGGGCTGAATGAGAACACGTTAAACTCGAGTTTAACGTGTTCTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks