EMAIL THIS PAGE TO A FRIEND

TRIM50

tripartite motif containing 50

Synonyms: TRIM50A
UniProtKB ID: Q86XT4, Q86XT3
Gene ID:
Mouse(215061) tripartite motif-containing 50
Rat(288596) tripartite motif-containing 50
cow(616685) tripartite motif containing 50
sheep(101116793) tripartite motif containing 50
naked mole-rat(101709438) tripartite motif containing 50
domestic guinea pig(100714398) tripartite motif containing 50
chicken(417461) tripartite motif containing 50
dog(489811) tripartite motif containing 50
domestic cat(101087188) tripartite motif containing 50
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178125 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178125 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178125 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178240 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178240 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178240 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU022461 MISSION® esiRNA esiRNA targeting mouse Trim50 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178125 Rosetta Predictions human pricing
NM_181080 Rosetta Predictions rat pricing
NM_178240 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216019 predicted 1752
2 SASI_Hs01_00216020 predicted 1441
3 SASI_Hs01_00216021 predicted 966
4 SASI_Hs01_00216022 predicted 903
5 SASI_Hs02_00369533 predicted 1778
6 SASI_Hs01_00216023 predicted 1020
7 SASI_Hs01_00216024 predicted 1739
8 SASI_Hs01_00216025 predicted 1285
9 SASI_Hs02_00369534 predicted 1022
10 SASI_Hs01_00216026 predicted 1357
11 SASI_Hs01_00216017 predicted 1791
12 SASI_Hs01_00216018 predicted 897
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181080 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069257 predicted 378
2 SASI_Rn01_00069258 predicted 716
3 SASI_Rn01_00069259 predicted 272
4 SASI_Rn01_00069260 predicted 844
5 SASI_Rn01_00069261 predicted 304
6 SASI_Rn01_00069262 predicted 969
7 SASI_Rn01_00069264 predicted 467
8 SASI_Rn01_00069265 predicted 476
9 SASI_Rn01_00069266 predicted 700
10 SASI_Rn02_00269659 predicted 1084
11 SASI_Rn01_00069263 predicted 1145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178240 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065291 predicted 399
2 SASI_Mm01_00065292 predicted 1147
3 SASI_Mm01_00065293 predicted 1222
4 SASI_Mm01_00065294 predicted 761
5 SASI_Mm01_00065295 predicted 935
6 SASI_Mm01_00065296 predicted 930
7 SASI_Mm01_00065297 predicted 836
8 SASI_Mm01_00065298 predicted 835
9 SASI_Mm01_00065299 predicted 474
10 SASI_Mm01_00065300 predicted 495
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178125
TRIM50 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 50
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178125.2-912s1c1
Sequence:CCGGCCACAAGTTCATCCGGAAGTTCTCGAGAACTTCCGGATGAACTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178125.2-1464s1c1
Sequence:CCGGGCAGGGCGAACTCACCTTCTTCTCGAGAAGAAGGTGAGTTCGCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178125.2-240s1c1
Sequence:CCGGGCTTCAGTGTCCCATCTGCCTCTCGAGAGGCAGATGGGACACTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178125.2-1756s1c1
Sequence:CCGGCGTCACTGTTTAGGAAGGTCTCTCGAGAGACCTTCCTAAACAGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178125.2-688s1c1
Sequence:CCGGCGAATCGTCAATGAGTCGGATCTCGAGATCCGACTCATTGACGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178125.2-1786s21c1
Sequence:CCGGTGTGTCCCTGGAACATGTAATCTCGAGATTACATGTTCCAGGGACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178125.2-1845s21c1
Sequence:CCGGAGGGTGTATTTGTAAACTTCGCTCGAGCGAAGTTTACAAATACACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178125.2-287s21c1
Sequence:CCGGTGCAGTGTGGCCACTCTTACTCTCGAGAGTAAGAGTGGCCACACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178125
TRIM50 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 50
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178125.2-912s1c1
Sequence:CCGGCCACAAGTTCATCCGGAAGTTCTCGAGAACTTCCGGATGAACTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178125.2-1464s1c1
Sequence:CCGGGCAGGGCGAACTCACCTTCTTCTCGAGAAGAAGGTGAGTTCGCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178125.2-240s1c1
Sequence:CCGGGCTTCAGTGTCCCATCTGCCTCTCGAGAGGCAGATGGGACACTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178125.2-1756s1c1
Sequence:CCGGCGTCACTGTTTAGGAAGGTCTCTCGAGAGACCTTCCTAAACAGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178125.2-688s1c1
Sequence:CCGGCGAATCGTCAATGAGTCGGATCTCGAGATCCGACTCATTGACGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178125.2-1786s21c1
Sequence:CCGGTGTGTCCCTGGAACATGTAATCTCGAGATTACATGTTCCAGGGACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178125.2-1845s21c1
Sequence:CCGGAGGGTGTATTTGTAAACTTCGCTCGAGCGAAGTTTACAAATACACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178125.2-287s21c1
Sequence:CCGGTGCAGTGTGGCCACTCTTACTCTCGAGAGTAAGAGTGGCCACACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178125
TRIM50 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 50
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178125.2-912s1c1
Sequence:CCGGCCACAAGTTCATCCGGAAGTTCTCGAGAACTTCCGGATGAACTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178125.2-1464s1c1
Sequence:CCGGGCAGGGCGAACTCACCTTCTTCTCGAGAAGAAGGTGAGTTCGCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178125.2-240s1c1
Sequence:CCGGGCTTCAGTGTCCCATCTGCCTCTCGAGAGGCAGATGGGACACTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178125.2-1756s1c1
Sequence:CCGGCGTCACTGTTTAGGAAGGTCTCTCGAGAGACCTTCCTAAACAGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178125.2-688s1c1
Sequence:CCGGCGAATCGTCAATGAGTCGGATCTCGAGATCCGACTCATTGACGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178125.2-1786s21c1
Sequence:CCGGTGTGTCCCTGGAACATGTAATCTCGAGATTACATGTTCCAGGGACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178125.2-1845s21c1
Sequence:CCGGAGGGTGTATTTGTAAACTTCGCTCGAGCGAAGTTTACAAATACACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178125.2-287s21c1
Sequence:CCGGTGCAGTGTGGCCACTCTTACTCTCGAGAGTAAGAGTGGCCACACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178240
TRIM50 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 50
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000040878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178240.1-487s1c1
Sequence:CCGGCGGATTATTAATGAGTCCGATCTCGAGATCGGACTCATTAATAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178240.1-825s1c1
Sequence:CCGGCATCAAACTGACCGTGTGGAACTCGAGTTCCACACGGTCAGTTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178240.1-1239s1c1
Sequence:CCGGCGGCGTCTACTTACACTATGACTCGAGTCATAGTGTAAGTAGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178240.1-1147s1c1
Sequence:CCGGGTGTGGCTAATTGGCCTGAAACTCGAGTTTCAGGCCAATTAGCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178240
TRIM50 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 50
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000040878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178240.1-487s1c1
Sequence:CCGGCGGATTATTAATGAGTCCGATCTCGAGATCGGACTCATTAATAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178240.1-825s1c1
Sequence:CCGGCATCAAACTGACCGTGTGGAACTCGAGTTCCACACGGTCAGTTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178240.1-1239s1c1
Sequence:CCGGCGGCGTCTACTTACACTATGACTCGAGTCATAGTGTAAGTAGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178240.1-1147s1c1
Sequence:CCGGGTGTGGCTAATTGGCCTGAAACTCGAGTTTCAGGCCAATTAGCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178240
TRIM50 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 50
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000040878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178240.1-487s1c1
Sequence:CCGGCGGATTATTAATGAGTCCGATCTCGAGATCGGACTCATTAATAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178240.1-825s1c1
Sequence:CCGGCATCAAACTGACCGTGTGGAACTCGAGTTCCACACGGTCAGTTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178240.1-1239s1c1
Sequence:CCGGCGGCGTCTACTTACACTATGACTCGAGTCATAGTGTAAGTAGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178240.1-1147s1c1
Sequence:CCGGGTGTGGCTAATTGGCCTGAAACTCGAGTTTCAGGCCAATTAGCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks