EMAIL THIS PAGE TO A FRIEND

TRIM51

tripartite motif-containing 51

Synonyms: SPRYD5 TRIM51A
Species: Human TRIM51(84767)
UniProtKB ID: Q9BSJ1, A6NMG2
Gene ID:
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032681 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032681 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032681 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148641 MISSION® esiRNA esiRNA human SPRYD5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032681 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360220 predicted 1158
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032681
TRIM51 MISSION shRNA Bacterial Glycerol Stock
tripartite motif-containing 51
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032681.3-1112s21c1
Sequence:CCGGATATTATTGGGAGGTTCATATCTCGAGATATGAACCTCCCAATAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032681.3-971s21c1
Sequence:CCGGTGAAAGAGCCAATAGTCATATCTCGAGATATGACTATTGGCTCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032681.3-1306s21c1
Sequence:CCGGCTACCAGCACAGTAGGATTATCTCGAGATAATCCTACTGTGCTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032681.1-376s1c1
Sequence:CCGGGCAAAGCCAGAATGGAACATTCTCGAGAATGTTCCATTCTGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032681.1-674s1c1
Sequence:CCGGCCCTCAAGATGATCCCGATATCTCGAGATATCGGGATCATCTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032681.1-578s1c1
Sequence:CCGGCAGTGGATTCAGAGTTGATTTCTCGAGAAATCAACTCTGAATCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032681.1-994s1c1
Sequence:CCGGGCTTTGTTGATGTTGATCAAACTCGAGTTTGATCAACATCAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032681.1-291s1c1
Sequence:CCGGCCTGCATTTCTCCATGAAGAACTCGAGTTCTTCATGGAGAAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032681
TRIM51 MISSION shRNA shRNA Plasmid DNA
tripartite motif-containing 51
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032681.3-1112s21c1
Sequence:CCGGATATTATTGGGAGGTTCATATCTCGAGATATGAACCTCCCAATAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032681.3-971s21c1
Sequence:CCGGTGAAAGAGCCAATAGTCATATCTCGAGATATGACTATTGGCTCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032681.3-1306s21c1
Sequence:CCGGCTACCAGCACAGTAGGATTATCTCGAGATAATCCTACTGTGCTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032681.1-376s1c1
Sequence:CCGGGCAAAGCCAGAATGGAACATTCTCGAGAATGTTCCATTCTGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032681.1-674s1c1
Sequence:CCGGCCCTCAAGATGATCCCGATATCTCGAGATATCGGGATCATCTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032681.1-578s1c1
Sequence:CCGGCAGTGGATTCAGAGTTGATTTCTCGAGAAATCAACTCTGAATCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032681.1-994s1c1
Sequence:CCGGGCTTTGTTGATGTTGATCAAACTCGAGTTTGATCAACATCAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032681.1-291s1c1
Sequence:CCGGCCTGCATTTCTCCATGAAGAACTCGAGTTCTTCATGGAGAAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032681
TRIM51 MISSION shRNA Lentiviral Transduction Particles
tripartite motif-containing 51
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032681.3-1112s21c1
Sequence:CCGGATATTATTGGGAGGTTCATATCTCGAGATATGAACCTCCCAATAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032681.3-971s21c1
Sequence:CCGGTGAAAGAGCCAATAGTCATATCTCGAGATATGACTATTGGCTCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032681.3-1306s21c1
Sequence:CCGGCTACCAGCACAGTAGGATTATCTCGAGATAATCCTACTGTGCTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032681.1-376s1c1
Sequence:CCGGGCAAAGCCAGAATGGAACATTCTCGAGAATGTTCCATTCTGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032681.1-674s1c1
Sequence:CCGGCCCTCAAGATGATCCCGATATCTCGAGATATCGGGATCATCTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032681.1-578s1c1
Sequence:CCGGCAGTGGATTCAGAGTTGATTTCTCGAGAAATCAACTCTGAATCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032681.1-994s1c1
Sequence:CCGGGCTTTGTTGATGTTGATCAAACTCGAGTTTGATCAACATCAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032681.1-291s1c1
Sequence:CCGGCCTGCATTTCTCCATGAAGAACTCGAGTTCTTCATGGAGAAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks