EMAIL THIS PAGE TO A FRIEND

TRIM51BP

tripartite motif-containing 51B, pseudogene

Synonyms: SPRYD5P SPRYD5P1
Species: Human TRIM51BP(399937)
Gene ID:
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001717775 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001717775 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001717775 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001717775 Rosetta Predictions human pricing
XM_001725082 Rosetta Predictions human pricing
XM_930197 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717775 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00419405 predicted 212
2 SASI_Hs02_00419406 predicted 282
3 SASI_Hs02_00419407 predicted 228
4 SASI_Hs02_00419408 predicted 227
5 SASI_Hs02_00419409 predicted 237
6 SASI_Hs02_00419410 predicted 241
7 SASI_Hs02_00419411 predicted 286
8 SASI_Hs02_00419412 predicted 241
9 SASI_Hs02_00419413 predicted 227
10 SASI_Hs02_00419414 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725082 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00465497 predicted 280
2 SASI_Hs02_00465498 predicted 224
3 SASI_Hs02_00465499 predicted 1476
4 SASI_Hs02_00465500 predicted 244
5 SASI_Hs02_00465501 predicted 1465
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265301 predicted 278
2 SASI_Hs01_00265302 predicted 230
3 SASI_Hs01_00265303 predicted 245
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001717775
TRIM51BP MISSION shRNA Bacterial Glycerol Stock
tripartite motif-containing 51B, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717775.1-640s21c1
Sequence:CCGGATCAGAAGATGCCTGCATTTCCTCGAGGAAATGCAGGCATCTTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717775.1-372s21c1
Sequence:CCGGGGGATGCACAGAGAGACAAAGCTCGAGCTTTGTCTCTCTGTGCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717775.1-788s21c1
Sequence:CCGGTCTGCAGCAAATGTATGAGTCCTCGAGGACTCATACATTTGCTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717775.1-234s21c1
Sequence:CCGGGTTCTTGCTCAGTGCTCTAAACTCGAGTTTAGAGCACTGAGCAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717775.1-697s21c1
Sequence:CCGGGAAAGGAGGGCGAGGACATTTCTCGAGAAATGTCCTCGCCCTCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001717775
TRIM51BP MISSION shRNA shRNA Plasmid DNA
tripartite motif-containing 51B, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717775.1-640s21c1
Sequence:CCGGATCAGAAGATGCCTGCATTTCCTCGAGGAAATGCAGGCATCTTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717775.1-372s21c1
Sequence:CCGGGGGATGCACAGAGAGACAAAGCTCGAGCTTTGTCTCTCTGTGCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717775.1-788s21c1
Sequence:CCGGTCTGCAGCAAATGTATGAGTCCTCGAGGACTCATACATTTGCTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717775.1-234s21c1
Sequence:CCGGGTTCTTGCTCAGTGCTCTAAACTCGAGTTTAGAGCACTGAGCAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717775.1-697s21c1
Sequence:CCGGGAAAGGAGGGCGAGGACATTTCTCGAGAAATGTCCTCGCCCTCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001717775
TRIM51BP MISSION shRNA Lentiviral Transduction Particles
tripartite motif-containing 51B, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717775.1-640s21c1
Sequence:CCGGATCAGAAGATGCCTGCATTTCCTCGAGGAAATGCAGGCATCTTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717775.1-372s21c1
Sequence:CCGGGGGATGCACAGAGAGACAAAGCTCGAGCTTTGTCTCTCTGTGCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717775.1-788s21c1
Sequence:CCGGTCTGCAGCAAATGTATGAGTCCTCGAGGACTCATACATTTGCTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717775.1-234s21c1
Sequence:CCGGGTTCTTGCTCAGTGCTCTAAACTCGAGTTTAGAGCACTGAGCAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717775.1-697s21c1
Sequence:CCGGGAAAGGAGGGCGAGGACATTTCTCGAGAAATGTCCTCGCCCTCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks