EMAIL THIS PAGE TO A FRIEND

TRIM51EP

tripartite motif-containing 51E, pseudogene

Species: Human TRIM51EP(399940)
Gene ID:
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001725093 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001725093 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001725093 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001725093 Rosetta Predictions human pricing
XM_374920 Rosetta Predictions human pricing
XM_934453 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725093 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00465572 predicted 212
2 SASI_Hs02_00465573 predicted 287
3 SASI_Hs02_00465574 predicted 223
4 SASI_Hs02_00465575 predicted 225
5 SASI_Hs02_00465576 predicted 234
6 SASI_Hs02_00465577 predicted 236
7 SASI_Hs02_00465578 predicted 284
8 SASI_Hs02_00465579 predicted 246
9 SASI_Hs02_00465580 predicted 223
10 SASI_Hs02_00465581 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_374920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00275452 predicted 286
2 SASI_Hs01_00275453 predicted 223
3 SASI_Hs01_00275454 predicted 225
4 SASI_Hs01_00275455 predicted 230
5 SASI_Hs01_00275456 predicted 238
6 SASI_Hs01_00275457 predicted 284
7 SASI_Hs01_00275458 predicted 244
8 SASI_Hs01_00275459 predicted 230
9 SASI_Hs01_00275460 predicted 228
10 SASI_Hs01_00275461 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257377 predicted 1231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001725093
TRIM51EP MISSION shRNA Bacterial Glycerol Stock
tripartite motif-containing 51E, pseudogene
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000244288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725093.1-586s21c1
Sequence:CCGGCCAGATGCTGGAAGGATTATGCTCGAGCATAATCCTTCCAGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725093.1-1313s21c1
Sequence:CCGGTACCAGCACAGTAGGATTATTCTCGAGAATAATCCTACTGTGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725093.1-1040s21c1
Sequence:CCGGCCCTCAAGATGATCCCGATATCTCGAGATATCGGGATCATCTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725093.1-789s21c1
Sequence:CCGGCTGAAGCAAATGTACCATAAACTCGAGTTTATGGTACATTTGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001725093
TRIM51EP MISSION shRNA shRNA Plasmid DNA
tripartite motif-containing 51E, pseudogene
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000244288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725093.1-586s21c1
Sequence:CCGGCCAGATGCTGGAAGGATTATGCTCGAGCATAATCCTTCCAGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725093.1-1313s21c1
Sequence:CCGGTACCAGCACAGTAGGATTATTCTCGAGAATAATCCTACTGTGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725093.1-1040s21c1
Sequence:CCGGCCCTCAAGATGATCCCGATATCTCGAGATATCGGGATCATCTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725093.1-789s21c1
Sequence:CCGGCTGAAGCAAATGTACCATAAACTCGAGTTTATGGTACATTTGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001725093
TRIM51EP MISSION shRNA Lentiviral Transduction Particles
tripartite motif-containing 51E, pseudogene
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000244288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725093.1-586s21c1
Sequence:CCGGCCAGATGCTGGAAGGATTATGCTCGAGCATAATCCTTCCAGCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725093.1-1313s21c1
Sequence:CCGGTACCAGCACAGTAGGATTATTCTCGAGAATAATCCTACTGTGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725093.1-1040s21c1
Sequence:CCGGCCCTCAAGATGATCCCGATATCTCGAGATATCGGGATCATCTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725093.1-789s21c1
Sequence:CCGGCTGAAGCAAATGTACCATAAACTCGAGTTTATGGTACATTTGCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks