EMAIL THIS PAGE TO A FRIEND

TRIM51GP

tripartite motif-containing 51G, pseudogene

Species: Human TRIM51GP(120824)
Gene ID:
33 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001720951 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001720951 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001720951 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001720951 Rosetta Predictions human pricing
XM_062300 Rosetta Predictions human pricing
XM_941867 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00439857 predicted 854
2 SASI_Hs02_00439858 predicted 945
3 SASI_Hs02_00439859 predicted 954
4 SASI_Hs02_00439860 predicted 885
5 SASI_Hs02_00439861 predicted 469
6 SASI_Hs02_00439862 predicted 849
7 SASI_Hs02_00439863 predicted 712
8 SASI_Hs02_00439864 predicted 954
9 SASI_Hs02_00439865 predicted 937
10 SASI_Hs02_00439866 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_062300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478732 predicted 856
2 SASI_Hs02_00478733 predicted 952
3 SASI_Hs02_00478734 predicted 948
4 SASI_Hs02_00478735 predicted 883
5 SASI_Hs02_00478736 predicted 464
6 SASI_Hs02_00478737 predicted 843
7 SASI_Hs02_00478738 predicted 715
8 SASI_Hs02_00478739 predicted 958
9 SASI_Hs02_00478740 predicted 935
10 SASI_Hs02_00478741 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_941867 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00485163 predicted 850
2 SASI_Hs02_00485164 predicted 950
3 SASI_Hs02_00485165 predicted 951
4 SASI_Hs02_00485166 predicted 882
5 SASI_Hs02_00485167 predicted 469
6 SASI_Hs02_00485168 predicted 845
7 SASI_Hs02_00485169 predicted 953
8 SASI_Hs02_00485170 predicted 943
9 SASI_Hs02_00485171 predicted 473
10 SASI_Hs02_00485172 predicted 958
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001720951
TRIM51GP MISSION shRNA Bacterial Glycerol Stock
tripartite motif-containing 51G, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720951.1-547s21c1
Sequence:CCGGTATCATAAGATGGTTGCATTTCTCGAGAAATGCAACCATCTTATGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720951.1-877s21c1
Sequence:CCGGCATGCAAGAGCCAGTAGTCATCTCGAGATGACTACTGGCTCTTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720951.1-845s21c1
Sequence:GTACCGGTCAAGGGATTCAGAGTTTATCCTCGAGGATAAACTCTGAATCCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720951.1-953s21c1
Sequence:CCGGATCCCAATATCACTGATAAATCTCGAGATTTATCAGTGATATTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720951.1-714s21c1
Sequence:CCGGTAAAGCAGTTGTGGAGCTATTCTCGAGAATAGCTCCACAACTGCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001720951
TRIM51GP MISSION shRNA shRNA Plasmid DNA
tripartite motif-containing 51G, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720951.1-547s21c1
Sequence:CCGGTATCATAAGATGGTTGCATTTCTCGAGAAATGCAACCATCTTATGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720951.1-877s21c1
Sequence:CCGGCATGCAAGAGCCAGTAGTCATCTCGAGATGACTACTGGCTCTTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720951.1-845s21c1
Sequence:GTACCGGTCAAGGGATTCAGAGTTTATCCTCGAGGATAAACTCTGAATCCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720951.1-953s21c1
Sequence:CCGGATCCCAATATCACTGATAAATCTCGAGATTTATCAGTGATATTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720951.1-714s21c1
Sequence:CCGGTAAAGCAGTTGTGGAGCTATTCTCGAGAATAGCTCCACAACTGCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001720951
TRIM51GP MISSION shRNA Lentiviral Transduction Particles
tripartite motif-containing 51G, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720951.1-547s21c1
Sequence:CCGGTATCATAAGATGGTTGCATTTCTCGAGAAATGCAACCATCTTATGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720951.1-877s21c1
Sequence:CCGGCATGCAAGAGCCAGTAGTCATCTCGAGATGACTACTGGCTCTTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720951.1-845s21c1
Sequence:GTACCGGTCAAGGGATTCAGAGTTTATCCTCGAGGATAAACTCTGAATCCCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720951.1-953s21c1
Sequence:CCGGATCCCAATATCACTGATAAATCTCGAGATTTATCAGTGATATTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720951.1-714s21c1
Sequence:CCGGTAAAGCAGTTGTGGAGCTATTCTCGAGAATAGCTCCACAACTGCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks