EMAIL THIS PAGE TO A FRIEND

TRIM52

tripartite motif containing 52

Synonyms: RNF102
UniProtKB ID: Q96A61
Gene ID:
Mouse(212085) tripartite motif-containing 52
Rat(290458) tripartite motif-containing 52
domestic cat(101083995) tripartite motif containing 52
cow(785347) tripartite motif containing 52
sheep(101107192) tripartite motif containing 52
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032765 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032765 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032765 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198601 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198601 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198601 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009441 MISSION® esiRNA esiRNA targeting human TRIM52 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032765 Rosetta Predictions human pricing
NM_001106056 Rosetta Predictions rat pricing
NM_198601 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032765 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165221 predicted 907
2 SASI_Hs01_00165222 predicted 868
3 SASI_Hs01_00165223 predicted 716
4 SASI_Hs01_00165224 predicted 1164
5 SASI_Hs01_00165226 predicted 1472
6 SASI_Hs01_00165227 predicted 1430
7 SASI_Hs01_00165228 predicted 732
8 SASI_Hs01_00165229 predicted 1222
9 SASI_Hs01_00165230 predicted 763
10 SASI_Hs02_00360307 predicted 1344
11 SASI_Hs01_00165225 predicted 1425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106056 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215192 predicted 398
2 SASI_Rn02_00215193 predicted 274
3 SASI_Rn02_00215194 predicted 360
4 SASI_Rn02_00215195 predicted 414
5 SASI_Rn02_00215196 predicted 276
6 SASI_Rn02_00215197 predicted 527
7 SASI_Rn02_00215198 predicted 311
8 SASI_Rn02_00215199 predicted 432
9 SASI_Rn02_00215200 predicted 520
10 SASI_Rn02_00215201 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198601 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049462 predicted 768
2 SASI_Mm01_00049464 predicted 1808
3 SASI_Mm01_00049465 predicted 1906
4 SASI_Mm01_00049466 predicted 1008
5 SASI_Mm02_00351001 predicted 1874
6 SASI_Mm01_00049467 predicted 740
7 SASI_Mm01_00049468 predicted 1306
8 SASI_Mm01_00049469 predicted 739
9 SASI_Mm01_00049470 predicted 1042
10 SASI_Mm01_00049471 predicted 1786
11 SASI_Mm01_00049463 predicted 995
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032765
TRIM52 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 52
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032765.2-1172s21c1
Sequence:CCGGCATTCACAGCAAGGCCTATAACTCGAGTTATAGGCCTTGCTGTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032765.2-1499s21c1
Sequence:CCGGTAGGAAGCAGACGGGTGTATACTCGAGTATACACCCGTCTGCTTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032765.2-690s21c1
Sequence:CCGGGAGGAAGATCAGGACTATTACCTCGAGGTAATAGTCCTGATCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032765.2-1422s1c1
Sequence:CCGGGCAAGCTAGAATCAAAGAATTCTCGAGAATTCTTTGATTCTAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032765.2-594s1c1
Sequence:CCGGCAAGACCAAGATGACGATGAACTCGAGTTCATCGTCATCTTGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032765.2-909s1c1
Sequence:CCGGGCCAACATGGTCCAGATAATTCTCGAGAATTATCTGGACCATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032765.2-750s1c1
Sequence:CCGGCGAGAAGAAGAAATACTGGAACTCGAGTTCCAGTATTTCTTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032765.2-771s1c1
Sequence:CCGGGCATACGATGAGGACGAAGATCTCGAGATCTTCGTCCTCATCGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032765
TRIM52 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 52
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032765.2-1172s21c1
Sequence:CCGGCATTCACAGCAAGGCCTATAACTCGAGTTATAGGCCTTGCTGTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032765.2-1499s21c1
Sequence:CCGGTAGGAAGCAGACGGGTGTATACTCGAGTATACACCCGTCTGCTTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032765.2-690s21c1
Sequence:CCGGGAGGAAGATCAGGACTATTACCTCGAGGTAATAGTCCTGATCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032765.2-1422s1c1
Sequence:CCGGGCAAGCTAGAATCAAAGAATTCTCGAGAATTCTTTGATTCTAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032765.2-594s1c1
Sequence:CCGGCAAGACCAAGATGACGATGAACTCGAGTTCATCGTCATCTTGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032765.2-909s1c1
Sequence:CCGGGCCAACATGGTCCAGATAATTCTCGAGAATTATCTGGACCATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032765.2-750s1c1
Sequence:CCGGCGAGAAGAAGAAATACTGGAACTCGAGTTCCAGTATTTCTTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032765.2-771s1c1
Sequence:CCGGGCATACGATGAGGACGAAGATCTCGAGATCTTCGTCCTCATCGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032765
TRIM52 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 52
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032765.2-1172s21c1
Sequence:CCGGCATTCACAGCAAGGCCTATAACTCGAGTTATAGGCCTTGCTGTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032765.2-1499s21c1
Sequence:CCGGTAGGAAGCAGACGGGTGTATACTCGAGTATACACCCGTCTGCTTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032765.2-690s21c1
Sequence:CCGGGAGGAAGATCAGGACTATTACCTCGAGGTAATAGTCCTGATCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034019    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032765.2-1422s1c1
Sequence:CCGGGCAAGCTAGAATCAAAGAATTCTCGAGAATTCTTTGATTCTAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032765.2-594s1c1
Sequence:CCGGCAAGACCAAGATGACGATGAACTCGAGTTCATCGTCATCTTGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032765.2-909s1c1
Sequence:CCGGGCCAACATGGTCCAGATAATTCTCGAGAATTATCTGGACCATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032765.2-750s1c1
Sequence:CCGGCGAGAAGAAGAAATACTGGAACTCGAGTTCCAGTATTTCTTCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032765.2-771s1c1
Sequence:CCGGGCATACGATGAGGACGAAGATCTCGAGATCTTCGTCCTCATCGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198601
TRIM52 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 52
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000040818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198601.1-1385s1c1
Sequence:CCGGGTCCATATAATTCGCCAGATTCTCGAGAATCTGGCGAATTATATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198601.1-1376s1c1
Sequence:CCGGGCCAACATGGTCCATATAATTCTCGAGAATTATATGGACCATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198601.1-1045s1c1
Sequence:CCGGCAGGAACAGTTTACAAGGATTCTCGAGAATCCTTGTAAACTGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198601.1-777s1c1
Sequence:CCGGGTGCCATCTGTCTGGATTATTCTCGAGAATAATCCAGACAGATGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198601
TRIM52 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 52
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000040818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198601.1-1385s1c1
Sequence:CCGGGTCCATATAATTCGCCAGATTCTCGAGAATCTGGCGAATTATATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198601.1-1376s1c1
Sequence:CCGGGCCAACATGGTCCATATAATTCTCGAGAATTATATGGACCATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198601.1-1045s1c1
Sequence:CCGGCAGGAACAGTTTACAAGGATTCTCGAGAATCCTTGTAAACTGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198601.1-777s1c1
Sequence:CCGGGTGCCATCTGTCTGGATTATTCTCGAGAATAATCCAGACAGATGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198601
TRIM52 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 52
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000040818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198601.1-1385s1c1
Sequence:CCGGGTCCATATAATTCGCCAGATTCTCGAGAATCTGGCGAATTATATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198601.1-1376s1c1
Sequence:CCGGGCCAACATGGTCCATATAATTCTCGAGAATTATATGGACCATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198601.1-1045s1c1
Sequence:CCGGCAGGAACAGTTTACAAGGATTCTCGAGAATCCTTGTAAACTGTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198601.1-777s1c1
Sequence:CCGGGTGCCATCTGTCTGGATTATTCTCGAGAATAATCCAGACAGATGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks