EMAIL THIS PAGE TO A FRIEND

TRIM53AP

tripartite motif containing 53A, pseudogene

Synonyms: TRIM53 TRIM53P TRIM80P
Species: Human TRIM53AP(642569)
Gene ID:
7 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145126 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145126 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145126 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_016180 Rosetta Predictions human pricing
XR_041244 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_016180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00490378 predicted 1241
2 SASI_Hs02_00490379 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525815 predicted 498
2 SASI_Hs02_00525816 predicted 8
3 SASI_Hs02_00525817 predicted 498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145126
TRIM53AP MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 53A, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145126.1-868s21c1
Sequence:CCGGTTCAGGGTTTCGGAGACATATCTCGAGATATGTCTCCGAAACCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145126.1-1349s21c1
Sequence:CCGGTACCAGCCGCATAGGATTATTCTCGAGAATAATCCTATGCGGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145126.1-259s21c1
Sequence:CCGGACTGGCAAGACATCCCAATTCCTCGAGGAATTGGGATGTCTTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145126.1-983s21c1
Sequence:CCGGCCAATTCTGAGTGGATATTACCTCGAGGTAATATCCACTCAGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145126.1-635s21c1
Sequence:CCGGCTGGAAGGATTATGTGAATTTCTCGAGAAATTCACATAATCCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145126
TRIM53AP MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 53A, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145126.1-868s21c1
Sequence:CCGGTTCAGGGTTTCGGAGACATATCTCGAGATATGTCTCCGAAACCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145126.1-1349s21c1
Sequence:CCGGTACCAGCCGCATAGGATTATTCTCGAGAATAATCCTATGCGGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145126.1-259s21c1
Sequence:CCGGACTGGCAAGACATCCCAATTCCTCGAGGAATTGGGATGTCTTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145126.1-983s21c1
Sequence:CCGGCCAATTCTGAGTGGATATTACCTCGAGGTAATATCCACTCAGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145126.1-635s21c1
Sequence:CCGGCTGGAAGGATTATGTGAATTTCTCGAGAAATTCACATAATCCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145126
TRIM53AP MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 53A, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145126.1-868s21c1
Sequence:CCGGTTCAGGGTTTCGGAGACATATCTCGAGATATGTCTCCGAAACCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145126.1-1349s21c1
Sequence:CCGGTACCAGCCGCATAGGATTATTCTCGAGAATAATCCTATGCGGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145126.1-259s21c1
Sequence:CCGGACTGGCAAGACATCCCAATTCCTCGAGGAATTGGGATGTCTTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145126.1-983s21c1
Sequence:CCGGCCAATTCTGAGTGGATATTACCTCGAGGTAATATCCACTCAGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145126.1-635s21c1
Sequence:CCGGCTGGAAGGATTATGTGAATTTCTCGAGAAATTCACATAATCCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks