EMAIL THIS PAGE TO A FRIEND

TRIM53BP

tripartite motif containing 53B, pseudogene

Synonyms: TRIM53B TRIM53L TRIM53L1 TRIM80P
Species: Human TRIM53BP(642425)
Gene ID:
8 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001146208 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001146208 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001146208 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_016154 Rosetta Predictions human pricing
XR_037827 Rosetta Predictions human pricing
XR_039420 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_016154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00490337 predicted 1244
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_037827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00503489 predicted 890
2 SASI_Hs02_00503490 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00510970 predicted 582
2 SASI_Hs02_00510971 predicted 866
3 SASI_Hs02_00510972 predicted 308
4 SASI_Hs02_00510973 predicted 1270
5 SASI_Hs02_00510974 predicted 17
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001146208
TRIM53BP MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 53B, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146208.1-982s21c1
Sequence:CCGGTCCAATTCTGAGTGGATATTACTCGAGTAATATCCACTCAGAATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146208.1-1349s21c1
Sequence:CCGGTACCAGCCACATAGGATTATTCTCGAGAATAATCCTATGTGGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146208.1-628s21c1
Sequence:CCGGTCAGCCACTGGAAGGATTATGCTCGAGCATAATCCTTCCAGTGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146208.1-423s21c1
Sequence:CCGGAGGGAGACAAAGAAGATATTCCTCGAGGAATATCTTCTTTGTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146208.1-870s21c1
Sequence:CCGGCAGGGTTTCGGAGACATATTACTCGAGTAATATGTCTCCGAAACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001146208
TRIM53BP MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 53B, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146208.1-982s21c1
Sequence:CCGGTCCAATTCTGAGTGGATATTACTCGAGTAATATCCACTCAGAATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146208.1-1349s21c1
Sequence:CCGGTACCAGCCACATAGGATTATTCTCGAGAATAATCCTATGTGGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146208.1-628s21c1
Sequence:CCGGTCAGCCACTGGAAGGATTATGCTCGAGCATAATCCTTCCAGTGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146208.1-423s21c1
Sequence:CCGGAGGGAGACAAAGAAGATATTCCTCGAGGAATATCTTCTTTGTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146208.1-870s21c1
Sequence:CCGGCAGGGTTTCGGAGACATATTACTCGAGTAATATGTCTCCGAAACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001146208
TRIM53BP MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 53B, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146208.1-982s21c1
Sequence:CCGGTCCAATTCTGAGTGGATATTACTCGAGTAATATCCACTCAGAATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001146208.1-1349s21c1
Sequence:CCGGTACCAGCCACATAGGATTATTCTCGAGAATAATCCTATGTGGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146208.1-628s21c1
Sequence:CCGGTCAGCCACTGGAAGGATTATGCTCGAGCATAATCCTTCCAGTGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146208.1-423s21c1
Sequence:CCGGAGGGAGACAAAGAAGATATTCCTCGAGGAATATCTTCTTTGTCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146208.1-870s21c1
Sequence:CCGGCAGGGTTTCGGAGACATATTACTCGAGTAATATGTCTCCGAAACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks