EMAIL THIS PAGE TO A FRIEND

TRIM54

tripartite motif containing 54

Synonyms: MURF MURF-3 RNF30 muRF3
UniProtKB ID: Q9BYV2, A5D8T7, Q53SY4, Q9BYV3
Gene ID:
Human(57159) Summary: The protein encoded by this gene contains a RING finger motif and is highly similar to the ring finger proteins RNF28/MURF1 and RNF29/MURF2. In vitro studies demonstrated that this protein, RNF28, and RNF29 form heterodimers, which may be important for the regulation of titin kinase and microtubule-dependent signal pathways in striated muscles. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(58522) tripartite motif-containing 54
Rat(362708) tripartite motif-containing 54
Zebrafish(563772) tripartite motif-containing 54
dog(475701) tripartite motif containing 54
Horse(100071225) tripartite motif containing 54
domestic cat(101090605) tripartite motif containing 54
cow(535320) tripartite motif containing 54
sheep(101111790) tripartite motif containing 54
domestic guinea pig(100727693) tripartite motif containing 54
naked mole-rat(101698305) tripartite motif containing 54
Gene Class: Cytoskeleton
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032546 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032546 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032546 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021447 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021447 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021447 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158851 MISSION® esiRNA esiRNA human TRIM54 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032546 Rosetta Predictions human pricing
NM_187841 Rosetta Predictions human pricing
NM_001013217 Rosetta Predictions rat pricing
NM_021447 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032546 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197937 predicted 938
2 SASI_Hs01_00197940 predicted 929
3 SASI_Hs01_00197941 predicted 1031
4 SASI_Hs02_00360053 predicted 281
5 SASI_Hs01_00197942 predicted 235
6 SASI_Hs01_00197943 predicted 1446
7 SASI_Hs01_00197944 predicted 942
8 SASI_Hs01_00197945 predicted 1077
9 SASI_Hs01_00197946 predicted 1062
10 SASI_Hs02_00360054 predicted 269
11 SASI_Hs01_00197938 predicted 1037
12 SASI_Hs01_00197939 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_187841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145403 predicted 813
2 SASI_Hs01_00145406 predicted 802
3 SASI_Hs01_00145407 predicted 904
4 SASI_Hs02_00371358 predicted 287
5 SASI_Hs01_00145408 predicted 240
6 SASI_Hs01_00145409 predicted 1322
7 SASI_Hs01_00145410 predicted 816
8 SASI_Hs01_00145411 predicted 958
9 SASI_Hs01_00145412 predicted 934
10 SASI_Hs02_00371359 predicted 267
11 SASI_Hs01_00145404 predicted 911
12 SASI_Hs01_00145405 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013217 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117892 predicted 405
2 SASI_Rn01_00117893 predicted 1090
3 SASI_Rn01_00117894 predicted 1026
4 SASI_Rn01_00117895 predicted 546
5 SASI_Rn01_00117896 predicted 697
6 SASI_Rn01_00117897 predicted 326
7 SASI_Rn01_00117898 predicted 735
8 SASI_Rn01_00117899 predicted 473
9 SASI_Rn01_00117900 predicted 670
10 SASI_Rn02_00201018 predicted 716
11 SASI_Rn01_00117901 predicted 1138
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021447 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118004 predicted 1061
2 SASI_Mm01_00118005 predicted 1141
3 SASI_Mm01_00118006 predicted 589
4 SASI_Mm01_00118007 predicted 518
5 SASI_Mm01_00118008 predicted 432
6 SASI_Mm01_00118009 predicted 586
7 SASI_Mm01_00118011 predicted 510
8 SASI_Mm01_00118012 predicted 917
9 SASI_Mm01_00118013 predicted 1208
10 SASI_Mm02_00326093 predicted 449
11 SASI_Mm01_00118010 predicted 1043
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032546
TRIM54 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 54
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032546.2-144s21c1
Sequence:CCGGCAAATGTGCCAACGACGTCTTCTCGAGAAGACGTCGTTGGCACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032546.2-745s21c1
Sequence:CCGGCGGAGGCAGAAGCAGTTGTTACTCGAGTAACAACTGCTTCTGCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032546.2-722s1c1
Sequence:CCGGGCCAGACTATCGAGGACAATACTCGAGTATTGTCCTCGATAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032546.2-96s1c1
Sequence:CCGGGTTCTCCAAACCAGTGGTGATCTCGAGATCACCACTGGTTTGGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032546.2-1049s1c1
Sequence:CCGGGCATGGAGCAATTCACCGTAACTCGAGTTACGGTGAATTGCTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032546.2-614s1c1
Sequence:CCGGCCTCGCAGAACACTAAGATTACTCGAGTAATCTTAGTGTTCTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032546.2-492s1c1
Sequence:CCGGCACCATTTACAAACGCCAGAACTCGAGTTCTGGCGTTTGTAAATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032546
TRIM54 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 54
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032546.2-144s21c1
Sequence:CCGGCAAATGTGCCAACGACGTCTTCTCGAGAAGACGTCGTTGGCACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032546.2-745s21c1
Sequence:CCGGCGGAGGCAGAAGCAGTTGTTACTCGAGTAACAACTGCTTCTGCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032546.2-722s1c1
Sequence:CCGGGCCAGACTATCGAGGACAATACTCGAGTATTGTCCTCGATAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032546.2-96s1c1
Sequence:CCGGGTTCTCCAAACCAGTGGTGATCTCGAGATCACCACTGGTTTGGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032546.2-1049s1c1
Sequence:CCGGGCATGGAGCAATTCACCGTAACTCGAGTTACGGTGAATTGCTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032546.2-614s1c1
Sequence:CCGGCCTCGCAGAACACTAAGATTACTCGAGTAATCTTAGTGTTCTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032546.2-492s1c1
Sequence:CCGGCACCATTTACAAACGCCAGAACTCGAGTTCTGGCGTTTGTAAATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032546
TRIM54 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 54
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032546.2-144s21c1
Sequence:CCGGCAAATGTGCCAACGACGTCTTCTCGAGAAGACGTCGTTGGCACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032546.2-745s21c1
Sequence:CCGGCGGAGGCAGAAGCAGTTGTTACTCGAGTAACAACTGCTTCTGCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032546.2-722s1c1
Sequence:CCGGGCCAGACTATCGAGGACAATACTCGAGTATTGTCCTCGATAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032546.2-96s1c1
Sequence:CCGGGTTCTCCAAACCAGTGGTGATCTCGAGATCACCACTGGTTTGGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032546.2-1049s1c1
Sequence:CCGGGCATGGAGCAATTCACCGTAACTCGAGTTACGGTGAATTGCTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032546.2-614s1c1
Sequence:CCGGCCTCGCAGAACACTAAGATTACTCGAGTAATCTTAGTGTTCTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032546.2-492s1c1
Sequence:CCGGCACCATTTACAAACGCCAGAACTCGAGTTCTGGCGTTTGTAAATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021447
TRIM54 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 54
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021447.2-790s1c1
Sequence:CCGGCACCATTTACAAACGCCAGAACTCGAGTTCTGGCGTTTGTAAATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021447.1-1112s1c1
Sequence:CCGGGCTATGAGAGCATGGAGCAATCTCGAGATTGCTCCATGCTCTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021447.1-252s1c1
Sequence:CCGGCAACTTGGAGAAGCAGCTCATCTCGAGATGAGCTGCTTCTCCAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021447.1-368s1c1
Sequence:CCGGCCTCTAATCCTCTGTGGCAATCTCGAGATTGCCACAGAGGATTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021447.1-817s1c1
Sequence:CCGGCGCAGACAGAAGCAACTGTTACTCGAGTAACAGTTGCTTCTGTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021447.1-585s1c1
Sequence:CCGGCGAGGACGAGAAGATCAACATCTCGAGATGTTGATCTTCTCGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021447.1-818s1c1
Sequence:CCGGGCAGACAGAAGCAACTGTTAACTCGAGTTAACAGTTGCTTCTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021447.1-819s1c1
Sequence:CCGGCAGACAGAAGCAACTGTTAAACTCGAGTTTAACAGTTGCTTCTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021447
TRIM54 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 54
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021447.2-790s1c1
Sequence:CCGGCACCATTTACAAACGCCAGAACTCGAGTTCTGGCGTTTGTAAATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021447.1-1112s1c1
Sequence:CCGGGCTATGAGAGCATGGAGCAATCTCGAGATTGCTCCATGCTCTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021447.1-252s1c1
Sequence:CCGGCAACTTGGAGAAGCAGCTCATCTCGAGATGAGCTGCTTCTCCAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021447.1-368s1c1
Sequence:CCGGCCTCTAATCCTCTGTGGCAATCTCGAGATTGCCACAGAGGATTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021447.1-817s1c1
Sequence:CCGGCGCAGACAGAAGCAACTGTTACTCGAGTAACAGTTGCTTCTGTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021447.1-585s1c1
Sequence:CCGGCGAGGACGAGAAGATCAACATCTCGAGATGTTGATCTTCTCGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021447.1-818s1c1
Sequence:CCGGGCAGACAGAAGCAACTGTTAACTCGAGTTAACAGTTGCTTCTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021447.1-819s1c1
Sequence:CCGGCAGACAGAAGCAACTGTTAAACTCGAGTTTAACAGTTGCTTCTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021447
TRIM54 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 54
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021447.2-790s1c1
Sequence:CCGGCACCATTTACAAACGCCAGAACTCGAGTTCTGGCGTTTGTAAATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021447.1-1112s1c1
Sequence:CCGGGCTATGAGAGCATGGAGCAATCTCGAGATTGCTCCATGCTCTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021447.1-252s1c1
Sequence:CCGGCAACTTGGAGAAGCAGCTCATCTCGAGATGAGCTGCTTCTCCAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021447.1-368s1c1
Sequence:CCGGCCTCTAATCCTCTGTGGCAATCTCGAGATTGCCACAGAGGATTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021447.1-817s1c1
Sequence:CCGGCGCAGACAGAAGCAACTGTTACTCGAGTAACAGTTGCTTCTGTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021447.1-585s1c1
Sequence:CCGGCGAGGACGAGAAGATCAACATCTCGAGATGTTGATCTTCTCGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021447.1-818s1c1
Sequence:CCGGGCAGACAGAAGCAACTGTTAACTCGAGTTAACAGTTGCTTCTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021447.1-819s1c1
Sequence:CCGGCAGACAGAAGCAACTGTTAAACTCGAGTTTAACAGTTGCTTCTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks