EMAIL THIS PAGE TO A FRIEND

TRIM55

tripartite motif containing 55

Synonyms: MURF-2 RNF29 muRF2
Gene ID:
Human(84675) Summary: The protein encoded by this gene contains a RING zinc finger, a motif known to be involved in protein-protein interactions. This protein associates transiently with microtubules, myosin, and titin during muscle sarcomere assembly. It may act as a transient adaptor and plays a regulatory role in the assembly of sarcomeres. Four alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(381485) tripartite motif-containing 55
Rat(365751) tripartite motif-containing 55
naked mole-rat(101718407) tripartite motif containing 55
Domestic Rabbit(100342024) tripartite motif containing 55
domestic guinea pig(100719571) tripartite motif containing 55
cow(616362) tripartite motif containing 55
sheep(101120926) tripartite motif containing 55
chicken(420166) tripartite motif containing 55
Horse(100052338) tripartite motif containing 55
domestic cat(101088139) tripartite motif containing 55
dog(486976) tripartite motif containing 55
228 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102563 Anti-TRIM55 (ab1) antibody produced in rabbit affinity isolated antibody bovine, rabbit, rat, guinea pig, horse, canine, human, mouse
western blot pricing
SAB2102564 Anti-TRIM55 (ab2) antibody produced in rabbit affinity isolated antibody rat, guinea pig, sheep, canine, zebrafish, pig, mouse, human, horse, bovine, rabbit
western blot pricing
SAB2102565 Anti-TRIM55 (ab3) antibody produced in rabbit affinity isolated antibody canine, mouse, rat, zebrafish, pig, guinea pig, horse, rabbit, bovine, human
western blot pricing
SAB2501572 Anti-TRIM55 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1408117 Anti-TRIM55 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1400748 Anti-TRIM55 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
HPA038793 Anti-TRIM55 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA053691 Anti-TRIM55 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1402642 Monoclonal Anti-TRIM55 antibody produced in mouse clone 1A1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033058 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033058 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033058 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081281 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081281 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081281 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086111 MISSION® esiRNA esiRNA human TRIM55 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033058 Rosetta Predictions human pricing
NM_184085 Rosetta Predictions human pricing
NM_184086 Rosetta Predictions human pricing
NM_184087 Rosetta Predictions human pricing
NM_001012218 Rosetta Predictions rat pricing
XM_574905 Rosetta Predictions rat pricing
NM_001081281 Rosetta Predictions mouse pricing
XM_355438 Rosetta Predictions mouse pricing
XM_884648 Rosetta Predictions mouse pricing
XM_895697 Rosetta Predictions mouse pricing
XM_895709 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069612 predicted 222
2 SASI_Hs01_00069613 predicted 367
3 SASI_Hs01_00069614 predicted 2181
4 SASI_Hs01_00069615 predicted 266
5 SASI_Hs01_00069616 predicted 355
6 SASI_Hs01_00069617 predicted 2222
7 SASI_Hs01_00069618 predicted 360
8 SASI_Hs01_00069619 predicted 354
9 SASI_Hs02_00360752 predicted 2157
10 SASI_Hs01_00069620 predicted 318
11 SASI_Hs01_00069621 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_184085 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013221 predicted 363
2 SASI_Hs01_00013222 predicted 2091
3 SASI_Hs01_00013224 predicted 356
4 SASI_Hs01_00013225 predicted 2135
5 SASI_Hs01_00013226 predicted 362
6 SASI_Hs01_00013227 predicted 2071
7 SASI_Hs01_00013228 predicted 317
8 SASI_Hs01_00013230 predicted 2208
9 SASI_Hs02_00371348 predicted 2087
10 SASI_Hs02_00371349 predicted 2304
11 SASI_Hs01_00013223 predicted 2011
12 SASI_Hs01_00013229 predicted 2011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_184086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168082 predicted 359
2 SASI_Hs01_00168083 predicted 1805
3 SASI_Hs01_00168085 predicted 361
4 SASI_Hs01_00168086 predicted 1849
5 SASI_Hs01_00168087 predicted 366
6 SASI_Hs01_00168088 predicted 1783
7 SASI_Hs01_00168089 predicted 316
8 SASI_Hs01_00168091 predicted 1919
9 SASI_Hs02_00371350 predicted 1806
10 SASI_Hs02_00371351 predicted 2007
11 SASI_Hs01_00168084 predicted 1723
12 SASI_Hs01_00168090 predicted 1723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_184087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229437 predicted 364
2 SASI_Hs01_00229438 predicted 1176
3 SASI_Hs01_00229440 predicted 357
4 SASI_Hs01_00229441 predicted 1217
5 SASI_Hs01_00229442 predicted 366
6 SASI_Hs01_00229443 predicted 1156
7 SASI_Hs01_00229444 predicted 317
8 SASI_Hs01_00229446 predicted 1282
9 SASI_Hs02_00371352 predicted 1173
10 SASI_Hs02_00371353 predicted 1374
11 SASI_Hs01_00229439 predicted 1092
12 SASI_Hs01_00229445 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012218 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041237 predicted 879
2 SASI_Rn01_00041238 predicted 1797
3 SASI_Rn01_00041239 predicted 1330
4 SASI_Rn01_00041240 predicted 921
5 SASI_Rn01_00041241 predicted 1634
6 SASI_Rn01_00041242 predicted 1821
7 SASI_Rn01_00041243 predicted 1213
8 SASI_Rn02_00200474 predicted 1125
9 SASI_Rn01_00041245 predicted 1812
10 SASI_Rn01_00041246 predicted 997
11 SASI_Rn01_00041244 predicted 1587
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574905 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00185055 predicted 878
2 SASI_Rn01_00185056 predicted 866
3 SASI_Rn01_00185057 predicted 924
4 SASI_Rn01_00185058 predicted 1004
5 SASI_Rn01_00185059 predicted 688
6 SASI_Rn01_00185060 predicted 761
7 SASI_Rn01_00185061 predicted 612
8 SASI_Rn01_00185062 predicted 810
9 SASI_Rn01_00185063 predicted 766
10 SASI_Rn01_00185064 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081281 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296937 predicted 1400
2 SASI_Mm02_00296938 predicted 1407
3 SASI_Mm02_00296939 predicted 1501
4 SASI_Mm02_00296940 predicted 216
5 SASI_Mm02_00296941 predicted 903
6 SASI_Mm02_00296942 predicted 868
7 SASI_Mm02_00296943 predicted 246
8 SASI_Mm02_00296944 predicted 849
9 SASI_Mm02_00296945 predicted 903
10 SASI_Mm02_00296946 predicted 1522
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270916 predicted 228
2 SASI_Mm01_00270917 predicted 245
3 SASI_Mm01_00270918 predicted 213
4 SASI_Mm01_00270919 predicted 239
5 SASI_Mm01_00270920 predicted 226
6 SASI_Mm01_00270921 predicted 544
7 SASI_Mm01_00270922 predicted 544
8 SASI_Mm01_00270923 predicted 287
9 SASI_Mm01_00270924 predicted 878
10 SASI_Mm01_00270925 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_884648 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283014 predicted 228
2 SASI_Mm01_00283015 predicted 246
3 SASI_Mm01_00283016 predicted 219
4 SASI_Mm01_00283017 predicted 237
5 SASI_Mm01_00283018 predicted 219
6 SASI_Mm01_00283019 predicted 1029
7 SASI_Mm01_00283020 predicted 547
8 SASI_Mm01_00283021 predicted 1420
9 SASI_Mm01_00283022 predicted 941
10 SASI_Mm01_00283023 predicted 1353
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895697 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00277879 predicted 267
2 SASI_Mm01_00277880 predicted 267
3 SASI_Mm01_00277881 predicted 245
4 SASI_Mm01_00277882 predicted 233
5 SASI_Mm01_00277883 predicted 251
6 SASI_Mm01_00277884 predicted 279
7 SASI_Mm01_00277885 predicted 229
8 SASI_Mm01_00277886 predicted 246
9 SASI_Mm01_00277887 predicted 472
10 SASI_Mm01_00277888 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227698 predicted 229
2 SASI_Mm01_00227699 predicted 245
3 SASI_Mm01_00227700 predicted 212
4 SASI_Mm01_00227701 predicted 278
5 SASI_Mm01_00227702 predicted 230
6 SASI_Mm01_00227703 predicted 227
7 SASI_Mm01_00227704 predicted 551
8 SASI_Mm01_00227705 predicted 289
9 SASI_Mm01_00227706 predicted 660
10 SASI_Mm01_00227707 predicted 155
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033058
TRIM55 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 55
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033058.2-1739s1c1
Sequence:CCGGGCTACTTCTCAGGAGTTAGTACTCGAGTACTAACTCCTGAGAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033058.2-353s1c1
Sequence:CCGGCAGCACAACCTGTGTAGGAAACTCGAGTTTCCTACACAGGTTGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033058.2-1135s1c1
Sequence:CCGGCTATGAGAACATGAACCACTTCTCGAGAAGTGGTTCATGTTCTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033058.2-1640s1c1
Sequence:CCGGCCAGGTTCTGAGGATTCGAATCTCGAGATTCGAATCCTCAGAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033058.2-856s1c1
Sequence:CCGGGCTTTGTGAGAAGTTTGATTACTCGAGTAATCAAACTTCTCACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033058.2-1028s21c1
Sequence:CCGGTTTATGGATGAGCCAGAAATGCTCGAGCATTTCTGGCTCATCCATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033058.2-2252s21c1
Sequence:CCGGGTCACTAACAAGTGGCAAATGCTCGAGCATTTGCCACTTGTTAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033058
TRIM55 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 55
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033058.2-1739s1c1
Sequence:CCGGGCTACTTCTCAGGAGTTAGTACTCGAGTACTAACTCCTGAGAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033058.2-353s1c1
Sequence:CCGGCAGCACAACCTGTGTAGGAAACTCGAGTTTCCTACACAGGTTGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033058.2-1135s1c1
Sequence:CCGGCTATGAGAACATGAACCACTTCTCGAGAAGTGGTTCATGTTCTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033058.2-1640s1c1
Sequence:CCGGCCAGGTTCTGAGGATTCGAATCTCGAGATTCGAATCCTCAGAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033058.2-856s1c1
Sequence:CCGGGCTTTGTGAGAAGTTTGATTACTCGAGTAATCAAACTTCTCACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033058.2-1028s21c1
Sequence:CCGGTTTATGGATGAGCCAGAAATGCTCGAGCATTTCTGGCTCATCCATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033058.2-2252s21c1
Sequence:CCGGGTCACTAACAAGTGGCAAATGCTCGAGCATTTGCCACTTGTTAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033058
TRIM55 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 55
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033058.2-1739s1c1
Sequence:CCGGGCTACTTCTCAGGAGTTAGTACTCGAGTACTAACTCCTGAGAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033058.2-353s1c1
Sequence:CCGGCAGCACAACCTGTGTAGGAAACTCGAGTTTCCTACACAGGTTGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033058.2-1135s1c1
Sequence:CCGGCTATGAGAACATGAACCACTTCTCGAGAAGTGGTTCATGTTCTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033058.2-1640s1c1
Sequence:CCGGCCAGGTTCTGAGGATTCGAATCTCGAGATTCGAATCCTCAGAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033058.2-856s1c1
Sequence:CCGGGCTTTGTGAGAAGTTTGATTACTCGAGTAATCAAACTTCTCACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033058.2-1028s21c1
Sequence:CCGGTTTATGGATGAGCCAGAAATGCTCGAGCATTTCTGGCTCATCCATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416802    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033058.2-2252s21c1
Sequence:CCGGGTCACTAACAAGTGGCAAATGCTCGAGCATTTGCCACTTGTTAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081281
TRIM55 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 55
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081281.1-1462s21c1
Sequence:CCGGTTTACCCTAGTTGGTATAAAGCTCGAGCTTTATACCAACTAGGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081281.1-316s21c1
Sequence:CCGGAGGCCTCTAACCCGTACTTACCTCGAGGTAAGTACGGGTTAGAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081281.1-658s21c1
Sequence:CCGGCAGAGCTCAGTGATGGTATTGCTCGAGCAATACCATCACTGAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081281.1-951s21c1
Sequence:CCGGTTCATGGATGAGCCCGAAATGCTCGAGCATTTCGGGCTCATCCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081281.1-247s21c1
Sequence:CCGGTCACGAAGCCTGTGGTCATTCCTCGAGGAATGACCACAGGCTTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081281
TRIM55 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 55
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081281.1-1462s21c1
Sequence:CCGGTTTACCCTAGTTGGTATAAAGCTCGAGCTTTATACCAACTAGGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081281.1-316s21c1
Sequence:CCGGAGGCCTCTAACCCGTACTTACCTCGAGGTAAGTACGGGTTAGAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081281.1-658s21c1
Sequence:CCGGCAGAGCTCAGTGATGGTATTGCTCGAGCAATACCATCACTGAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081281.1-951s21c1
Sequence:CCGGTTCATGGATGAGCCCGAAATGCTCGAGCATTTCGGGCTCATCCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081281.1-247s21c1
Sequence:CCGGTCACGAAGCCTGTGGTCATTCCTCGAGGAATGACCACAGGCTTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081281
TRIM55 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 55
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081281.1-1462s21c1
Sequence:CCGGTTTACCCTAGTTGGTATAAAGCTCGAGCTTTATACCAACTAGGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081281.1-316s21c1
Sequence:CCGGAGGCCTCTAACCCGTACTTACCTCGAGGTAAGTACGGGTTAGAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081281.1-658s21c1
Sequence:CCGGCAGAGCTCAGTGATGGTATTGCTCGAGCAATACCATCACTGAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081281.1-951s21c1
Sequence:CCGGTTCATGGATGAGCCCGAAATGCTCGAGCATTTCGGGCTCATCCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081281.1-247s21c1
Sequence:CCGGTCACGAAGCCTGTGGTCATTCCTCGAGGAATGACCACAGGCTTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks