EMAIL THIS PAGE TO A FRIEND

TRIM56

tripartite motif containing 56

Synonyms: RNF109
UniProtKB ID: Q9BRZ2, Q6PJS5, Q86VT6, Q8N2H8, Q8NAC0, Q9H031
Gene ID:
Mouse(384309) tripartite motif-containing 56
dog(608281) tripartite motif containing 56
Horse(100060136) tripartite motif containing 56
domestic cat(101088639) tripartite motif containing 56
cow(514896) tripartite motif containing 56
sheep(101120134) tripartite motif containing 56
domestic guinea pig(100727035) tripartite motif containing 56
Domestic Rabbit(100356761) tripartite motif containing 56
naked mole-rat(101704278) tripartite motif containing 56
41 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030961 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030961 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030961 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201373 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201373 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201373 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051151 MISSION® esiRNA esiRNA human TRIM56 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030961 Rosetta Predictions human pricing
NM_201373 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069984 predicted 1777
2 SASI_Hs01_00069985 predicted 2476
3 SASI_Hs01_00069986 predicted 2400
4 SASI_Hs01_00069987 predicted 2783
5 SASI_Hs01_00069988 predicted 2967
6 SASI_Hs01_00069989 predicted 1827
7 SASI_Hs02_00358542 predicted 2301
8 SASI_Hs01_00069990 predicted 2789
9 SASI_Hs01_00069991 predicted 2366
10 SASI_Hs01_00069993 predicted 2192
11 SASI_Hs01_00069992 predicted 2340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201373 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065321 predicted 301
2 SASI_Mm02_00351549 predicted 467
3 SASI_Mm01_00065322 predicted 304
4 SASI_Mm01_00065323 predicted 1362
5 SASI_Mm01_00065325 predicted 929
6 SASI_Mm01_00065326 predicted 810
7 SASI_Mm01_00065327 predicted 1762
8 SASI_Mm01_00065328 predicted 283
9 SASI_Mm01_00065329 predicted 1362
10 SASI_Mm01_00065330 predicted 704
11 SASI_Mm01_00065324 predicted 2262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030961
TRIM56 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 56
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030961.1-277s21c1
Sequence:CCGGAGCGACTTCCTGGCCTGTAAACTCGAGTTTACAGGCCAGGAAGTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030961.1-2059s21c1
Sequence:CCGGCACGTGGAGGTGTACAATATGCTCGAGCATATTGTACACCTCCACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030961.1-2644s1c1
Sequence:CCGGCGTCTTCTAGTGTGTGAGAATCTCGAGATTCTCACACACTAGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030961.1-2190s1c1
Sequence:CCGGGCAGCAGAATAGTGTGGTAATCTCGAGATTACCACACTATTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030961.1-591s1c1
Sequence:CCGGCCTGGACTGTGCCGATGACTTCTCGAGAAGTCATCGGCACAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030961.1-1932s1c1
Sequence:CCGGCGCACGGCTCTATCTCATCAACTCGAGTTGATGAGATAGAGCCGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030961.1-2286s1c1
Sequence:CCGGTGTGGATAAGAAGGGCTACATCTCGAGATGTAGCCCTTCTTATCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030961
TRIM56 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 56
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030961.1-277s21c1
Sequence:CCGGAGCGACTTCCTGGCCTGTAAACTCGAGTTTACAGGCCAGGAAGTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030961.1-2059s21c1
Sequence:CCGGCACGTGGAGGTGTACAATATGCTCGAGCATATTGTACACCTCCACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030961.1-2644s1c1
Sequence:CCGGCGTCTTCTAGTGTGTGAGAATCTCGAGATTCTCACACACTAGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030961.1-2190s1c1
Sequence:CCGGGCAGCAGAATAGTGTGGTAATCTCGAGATTACCACACTATTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030961.1-591s1c1
Sequence:CCGGCCTGGACTGTGCCGATGACTTCTCGAGAAGTCATCGGCACAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030961.1-1932s1c1
Sequence:CCGGCGCACGGCTCTATCTCATCAACTCGAGTTGATGAGATAGAGCCGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030961.1-2286s1c1
Sequence:CCGGTGTGGATAAGAAGGGCTACATCTCGAGATGTAGCCCTTCTTATCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030961
TRIM56 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 56
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030961.1-277s21c1
Sequence:CCGGAGCGACTTCCTGGCCTGTAAACTCGAGTTTACAGGCCAGGAAGTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030961.1-2059s21c1
Sequence:CCGGCACGTGGAGGTGTACAATATGCTCGAGCATATTGTACACCTCCACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030961.1-2644s1c1
Sequence:CCGGCGTCTTCTAGTGTGTGAGAATCTCGAGATTCTCACACACTAGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030961.1-2190s1c1
Sequence:CCGGGCAGCAGAATAGTGTGGTAATCTCGAGATTACCACACTATTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030961.1-591s1c1
Sequence:CCGGCCTGGACTGTGCCGATGACTTCTCGAGAAGTCATCGGCACAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030961.1-1932s1c1
Sequence:CCGGCGCACGGCTCTATCTCATCAACTCGAGTTGATGAGATAGAGCCGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030961.1-2286s1c1
Sequence:CCGGTGTGGATAAGAAGGGCTACATCTCGAGATGTAGCCCTTCTTATCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201373
TRIM56 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 56
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201373.3-2401s21c1
Sequence:CCGGGTACTTGGTGGTGTCACTTAGCTCGAGCTAAGTGACACCACCAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201373.3-2561s21c1
Sequence:CCGGATGAGTTGGCCAAGGGCATTTCTCGAGAAATGCCCTTGGCCAACTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201373.3-624s21c1
Sequence:CCGGTGGACTGTGCCGACGACTTATCTCGAGATAAGTCGTCGGCACAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201373.3-308s21c1
Sequence:CCGGAGCGATTTCCTAGCCTGTAAACTCGAGTTTACAGGCTAGGAAATCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201373.1-3403s1c1
Sequence:CCGGCGGAGTAGAAACTCCCTCAATCTCGAGATTGAGGGAGTTTCTACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201373.1-796s1c1
Sequence:CCGGGCTTCCTCTGTCAACCTTGTTCTCGAGAACAAGGTTGACAGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201373.1-1457s1c1
Sequence:CCGGCGATAGAACCAAGATAGGGAACTCGAGTTCCCTATCTTGGTTCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201373.1-2435s1c1
Sequence:CCGGCCATGTCTTTAGGGTCAGGTTCTCGAGAACCTGACCCTAAAGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201373.1-476s1c1
Sequence:CCGGCGCCTTTAAGACCAACTTCTTCTCGAGAAGAAGTTGGTCTTAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201373
TRIM56 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 56
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201373.3-2401s21c1
Sequence:CCGGGTACTTGGTGGTGTCACTTAGCTCGAGCTAAGTGACACCACCAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201373.3-2561s21c1
Sequence:CCGGATGAGTTGGCCAAGGGCATTTCTCGAGAAATGCCCTTGGCCAACTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201373.3-624s21c1
Sequence:CCGGTGGACTGTGCCGACGACTTATCTCGAGATAAGTCGTCGGCACAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201373.3-308s21c1
Sequence:CCGGAGCGATTTCCTAGCCTGTAAACTCGAGTTTACAGGCTAGGAAATCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201373.1-3403s1c1
Sequence:CCGGCGGAGTAGAAACTCCCTCAATCTCGAGATTGAGGGAGTTTCTACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201373.1-796s1c1
Sequence:CCGGGCTTCCTCTGTCAACCTTGTTCTCGAGAACAAGGTTGACAGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201373.1-1457s1c1
Sequence:CCGGCGATAGAACCAAGATAGGGAACTCGAGTTCCCTATCTTGGTTCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201373.1-2435s1c1
Sequence:CCGGCCATGTCTTTAGGGTCAGGTTCTCGAGAACCTGACCCTAAAGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201373.1-476s1c1
Sequence:CCGGCGCCTTTAAGACCAACTTCTTCTCGAGAAGAAGTTGGTCTTAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201373
TRIM56 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 56
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201373.3-2401s21c1
Sequence:CCGGGTACTTGGTGGTGTCACTTAGCTCGAGCTAAGTGACACCACCAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201373.3-2561s21c1
Sequence:CCGGATGAGTTGGCCAAGGGCATTTCTCGAGAAATGCCCTTGGCCAACTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201373.3-624s21c1
Sequence:CCGGTGGACTGTGCCGACGACTTATCTCGAGATAAGTCGTCGGCACAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201373.3-308s21c1
Sequence:CCGGAGCGATTTCCTAGCCTGTAAACTCGAGTTTACAGGCTAGGAAATCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201373.1-3403s1c1
Sequence:CCGGCGGAGTAGAAACTCCCTCAATCTCGAGATTGAGGGAGTTTCTACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201373.1-796s1c1
Sequence:CCGGGCTTCCTCTGTCAACCTTGTTCTCGAGAACAAGGTTGACAGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201373.1-1457s1c1
Sequence:CCGGCGATAGAACCAAGATAGGGAACTCGAGTTCCCTATCTTGGTTCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201373.1-2435s1c1
Sequence:CCGGCCATGTCTTTAGGGTCAGGTTCTCGAGAACCTGACCCTAAAGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201373.1-476s1c1
Sequence:CCGGCGCCTTTAAGACCAACTTCTTCTCGAGAAGAAGTTGGTCTTAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks